Description :
From Genome Similarity Track
Location :
Scaffold_4:118294- 119503
Transcript NameFunction/comments
Phymu_g320hypothetical protein PHYSODRAFT_260330

Sequence
1209 bases(100 bases per row)
CTTAGAAGCGCATATCGTGAACACGATCGTTTTTGGTCAGAGTGAATTTAGCGTTCAGGTACGCTCGGAGATAAGGCTCGTTCGCCAGCTTTTGCATCAG
TAGGGCGTCCACCGTTTTCTGATCCTGCTTTCGTTGCTCCGCAATCACAGGCACAGTCTGCGCAAAACGAAAGCCACCGTCAGTTcaacaggaggaggaa
cttTTGCGATCCCAAGCGCATTTTGCAAACCCCATCGCCACACTTTCGACTCGCAGGGAATACATAAACACAGGATCCTCGCATAGTGCAGCACGACCGT
AGTCAACGTACCGGGGTCTGTTGAGCCGCGAAGAAGCGATCCTCCTTGCTGCTTTTCTTGGCAGGCTTGTCCTTCGTAAAGTACTCGTCATCGATTTCCG
GCAACTTCACACCCGTAAGGTCCAGTCGGGTGGACGTAGCAATCACAAAAGCCTGGTTCACGCGACGTAGCGGCACACCGTTCACCTTGTACGGGCCTGC
AACGCACAACATGAACCCTGTCAGCAACATGACTCGACTCCTCCAGAGATCTCATCGATCAGCGCAGTTTCGGAAGTGTGCACTCGTCAAAGATCTAAAG
CCAGCATTCCTCAGGTCTCATAATCTGAAGGATCTTTGGCACGTAGTCCGCTTCCCCCCATCCACCACGGCATCCCTACCGGTGACCCGCATGCCCCAGG
CCGTTGTATGCGACCTTTTGGTTCAAAACCAACAGGCCAGCAGTTGTCAGCACTGGTGCACGAGACGGAGGGAGCCGCGAAAAGATGAAAGAAGAGATGA
CATGGTGCCTTTCAGTGTCAAGTTTGCATCATCGGAATGCCAGCAGTCGGTATCTACACGACTCCAGTGTTGACTCACCCGTGACCAGCAGTGTGCCCGA
CGGCAGCTGCTTGAGGAACACCACGCGTTTTCCCCGAAAGCGTCCAGACAGCAGGATGAGCACCGTTCCTGGAGTGATGGACTTGCGCAACTTAGCCGTC
TTGACGCTGTtgcgcttggtcttggcGGATGGCAGTGGCTTGGGGATGAAGTCCGCCGGATACCACTTATTGGTCGAGGGCACGGGCTGCGTGGAGGCCT
TCCGGACCTTGGTTTTGTTGTTGGAAGCGCTGTGAGAAAATACTCGGCCGTTGGTCTTAGCCAGACTGTTGGCGGAAATCGCGTTGATGCCTCGGGCCAA
CACAACGTT