Description :
From Genome Similarity Track
Location :
Scaffold_134:11828- 22033
Transcript NameFunction/comments
Phyke_g4776Voltage-gated Ion Channel (VIC) Superfamily
Phyke_g4777hypothetical protein
Phyke_g4778conserved hypothetical protein

Sequence
10205 bases(100 bases per row)
GCACGCGTCCTGAAGATGTCGCGGTATTCGTCTGCTATCCAGGTGTTCACACAGGCAATCGCCATCAGCATTAAGCCATTGAGCATGCTAATTTTCCTCA
TGTCTATTGCCATGATCATATTTTCATCTGCCATCTATTTCGCCGAGTTCACGAACGACGGATGTCGTTCGGGTGGCTGGATTGGGAAGTGTGATGTCTC
TCAATCGGGGGAAATTGATACCGTGGACGTAAGTTATTCCGTGTCCATTGCCGCAGCAGTAGCATCCGTGTCGGCGTCTGACGCCTGCGTGTGTGTGGAT
CCAAACCCATACCAAGGAATTGCAACGTCATTTTGGTGGTGCATCGTGACAATGTCCACCGTGGGCTATGGTGACATGACACCAGTAACTTGGATGGGCA
AGGTCGTTGGTTGCTGCACCGTTCTCACAGGAATGCTCGTGCTAGCATTGCCTATCACCGTCATAGGCACCAACTTCCAGAAAGTCATGAAGTCGGTCAT
GCATGAAACTATGAAGAGCAATGTGGATTACCTCAAAGGCAAGCGCATGTTGTGTCGAAATGAGATCGAAGCCATATTGGAGCGTTTTCACGCGGTGACC
GAAGGGATCCACCTGGACATCGATGATGTGATTAACGTCTATGACACCGACAATAGTGGCAtgcttgaggatgaagagctcgCCAAATTTCGTAATGATC
TAGAGGTATTGCAAAATCGCGCCTTTATGAATCAGTTGGTTGTGCCAGGTGTCATTCTCCAGCAGAACCATCGCAAAGGCACAATAACAAGGCTCCGGTC
GGGTGCGGCCAGTGTTTCGCCAACCTCAAATGATCTGATACTCCAGAGCAAAGCTGTACATATCGACAATactggacgacgtcaccCGGTCGTGGAAAAG
CAGGTATCGACCACCAtcgttggtgttggcgcCCTCAGCGCTAAGTTGGGCCCGGATCTGTTCCCAGAGAACGGACCAAGTTCCGATGCAACAGTGTTAG
CTAGATTTTCTTCTTTCCCAGACCTTCAACGCAAACCACCAGGGATCAGTGCTACCCCGCACCACTTAGGTGACAACGAACTCATGTTTCGGTTGCTTGA
AATGCAGGAGAGTTTTCAAGATCGCTTGCTTGAGACGGAACAACGACTCGAAGCTAAGCTCAACAACCTTACCAAGATCCTCATGCGTCTTGAAGGTATG
ATGGAGAGCGAAGATTAGAAGAAAGCAATTGACGTTCAAAATTGATAGATAGACTTGGTGAGCACTAGTACTTCGAAATAGAATGATTTTGATATCTACC
TTTGTTTTTACGTGTGGACTCTTCATTTGACCGGCGTTGCTTGGAGGTTGGCAAAACTTGCACGAGTTTCCCTTGGGTCCATAGTTCCCTTCGGAACTAG
CATTTCCATGAAGAGTGCGAATGCGTCTTCCCACATATCCATATCATCTCGGAGCACACCATATAGCGTTCGCCTTAGCATTAGGCTTTTGTGCCTCATC
TTTACGTCGTCGTTCACAACGCTCCCACGCTTGGGGGTGAAAGTAGCCCCCCCCTGGGCACTTTCACCTTCgtctttgtcgtcgtcatcattATCGCTGT
CATAATCGCTCACATCCATGTCAACATCCTCAGCGTTGTCGCTACTGCATGCACTAAGCCAGGTGGCCATGAATTCGACGGTTGATTTTTTCTGCTGGAC
GGCTAGCTGTGCAGTTGCCAGTACCAATTGGAAATAATGATGTGACTGGAGTATTTGGAGCAGGTGTTCGGAGTTCAATACGAACAGATCACACGCTCGA
ATAGTTGACACAGTTTGCAGACTTACGGAATGGCCTAGCAAACCATTTTCCCCAAAGTAGTCGCCACTCCGGAAGTGGCTAGCAGGGAACATTTCTGAAT
TGGATACACTCTTGGACAGCAAGTACCCACGAACGACGAAATACATGGCCTTACATAGGCTGCCTTCCACGATCACATTTTCGCCTCGTGGATATCCTTC
GAATCGCAAACACTTTGCGATAGCGTACGTGAGGTTGCCAAGATTCAATTCACCACCGGCGGGATTTTCACCTCCGTCAACCTGCCCTCTATCTTGAAAC
CCATCACGAACAAGGGGTCGAAACACACGATCCACGAACAAACTGAGTGGGTGCTTCGCGATGGCTAATATCCCCTCAGTACGCACGCTAGCAGGGAGGT
CTTCAAAAATCAATTGATAATCGACGCCCGCGTGAGAGGACCACCATGATGTGAGGAAGGTATCTGCGCGCCGTTTTAACGCTGGGCTGACTTTCCAGCG
CGCAAGAAATCGTTGGACGATGAGGTGGTTCTTGCGGAACTGTACCTCATTATTGATGTAAAGCAGGAAGATGTTGGCCATTTCAGCGATCATAAGGGCC
ATGATAAGTTGACCACCGAATGAGATGACAAGGGTGAACGCGAAGTTGAGCTGTGACGCAGGCACGAATGTTCGGTTCTTTTTCACAAAAGCTGTCACTG
CAAACGATAAGCCTCGGAAAAGTCTCTTCAATAACAACTCTGGAGACGGATCCGAGTCTTCAAGCAAAATTGAAGGCAACCAATTTTGCCATTCTGTTCC
AAACCCATCATGTATCGATACGCCAAAGTAGGCGCATGACGTCCAGAACATTGCTAATACGTACAGGAGCCAGAGTGTCTGCACACGATTAACTTCGTAT
GAGACGCTGCGGCGTGTGATTTCGTTGCGATAGTACACCAAGTTACCGACTTTCAAACAACGATTTAGTCGTAGCCACTTGTGGAGCAACGCTCTGTCAA
GTCCTTCAAACCCAACGAGGAAGTTTGCTGCAAAGTGATCCAACGGAAAAGTAGCAGCCAAATCCACAGCGAATCGCTCGCGTTTGTAAGCTATGAGCTG
GTCTTGCTCGTACAACTCCATTGCCCCTTGACTTTTGCGCATATGGAATTGAAACCAAATATCGACCCAAAAAATCACCTCACACAGTGCCTCAGCAGTC
CGCAGGCACACCGGGATCACGTTCCACCGGTCCAGCGAATCATACGTGAGGCGATAGGGCACCATCACTGCCACGTAAACTGTGCAGACAGATACTAGAC
GCATCCACCGCAAGTAGACAGAGCTTTGAATTTCCGCACCGTGGGCTAGTtgactggcagcagccttcaATGAATACCATGCAGGGATCGCACATCGCAC
TACAGCTGGTGATGAACAAGTTTTGCTCCACTGTTGTGTGAACCAAAGTCTCACCAGGTTAGGTGTAACATCCGATGTCTGTGCTTCCTTTCGGTAGCTG
AGGAGAACCTTTTCAATATTTTCCGCTTGAGCATTAATCACATCCATCCGGGATTCTCCACGCCTGACTCCGCGGCGACGGACCGCAGATTCAGCTTCTG
GCGCTTGTGCTTCAAACGCAAGGCGCTGTAatcgttgttgctgttgctgaatcTTGGCGATACGAAGAACTTTTTGTTGCCACTCGGGATAGCGAGCGAA
AACCAGCTCAAGGGATTGTCGCGATAACTTGTACAGGATGCACGATGTGTTAGCTTTAACGTGCGCATTGCGCGGTGTGTTTGTGAATAGTGCAGCCTCA
CCGAAATAACTCCCAGCCGTAATTTCGTTGACTTTGCGTAGCCCACTCACACTCACACGCGCACCTGAAGCTGAGGTTGGATAGCTAATTGCACCACCGA
GTGTTGGGTTACCAGTTGCAGGTGCCATTGGTGTTAACAACGGGATGTAGATGTCGAGTACGCCGGTGTAAATGAAAAACATCTCGCTACCTTCCTCACC
GAAATGGCATATAAATTCATCCTTGACAAACAATACTTGTGTAAAAAGAGAAACAAGCATGCGCGTGACTGAGTCTTCCATTCCGACAAGAAATGCCACT
TTCACAATCATTGGCTGCAACTGAAACATTCGCATATCCACAACCAGGGAGGGTGGTAGCACCCGCTCAAGTTCATGCTCTTTTGTAATGGAATGGAAat
gcttgaagaagaagagattctTGAATTTCTCCTCGACGCCTGGAGGCAAGTCAAAGTGTCGGAGAAGCTGGCGTAGAGAGCTCAACTTGGCCACAAAGTG
TCGGTTTTCGGAATCCTGCAGCTCGATTACGTCTGAAATATGACCGACAACGTACGCGAATAGGAAAAATCCCACCGTCATAGTGAGTATACTAAAGATG
CACTCACCAACTGCCTTCGGTAGCTCACCCTGGCTTGAGTTTGACATGAGTCCATACGACCAAAACAACGATGTTAAGTACTGAAGTCCTCGCTCGGCTG
TTTCCAATGACTCATAAGGCCCCCACGTAGTTGCACCAAAGGATGAGCCACTAGCCCCACTCAAAACACCGTGAATTCCAGAGTTGTTGGCTGCAAAATC
GAACCAAACGCTTCCAAACATGTGCGCCGCAATAAACGAATAGTAAACCAACCTAAGGAGACGTAATTCCGATGTAAGTGTCACGTACTTGGTCTCGAGT
GTACGGAACTGACTGGAGCCCTTGAAGTACCTCAGCATCTTATTAGTATTTAGCACCTCTAAGCGTGAATTTGGTAGGGTCCAATTCAGAATGAACAGCG
GCACGAGAGCAGCCATGTCAAGTGCAAAATGTGCCGATCGTAAGTAGCGTCTCTGAATCACTACGATATCCATGACCTTGTTTCCATACTCGTAAAAGCC
CAAGCGCAAGTGCAAATAAACATCCAAAACGAAAAGAAGTTCCAATGTAACCATGGCAGTGTCAGCAAACGCACGGCCACTCGAGCTCCTATCCACACCA
AAGCAGATGTAATACATCACAAGAGCTCCTTGCACCGTCGATGCCAATAACATGCTTGCCTCCCATAAACCCACAAACACCCAGTCGGGATCAATTGCTT
TGCCTCGTCGCCACCACTCCACGTTCTTCGCAAACATCTCCACAAGCCCTGTCGTTCGCTTGCGCCGTAATGCCCGACGCAAGGTTGGGGGATTTTTCAT
TCCGACAGCACCAATCCCCACACGAGATTGCAACGACCGTAGATCCGCCGATCGTGCGACCCGTGCGTCATGTAGCCGTTGCTCTAATGATCTCAAGCTT
TCAGGTAGCTTAGGGAAAATGTCCTCCATCGTATGAAGGTGTTCCCGGGAAACATACACAACGATGCAGCCGCTCACAGCAGTCACACGCTCTGAATATC
CAATACTTGCAGTTGTTGCGCTGGTAGAGCGTCGTCTCCCTGCTCGCCTACTCTCGTTCCTGCCGGATTGTGCTGATGGAAATGCTGCAATCCCGAAAAA
CCCACCCAGAGGAACGCGTCGAGGCAAATCGCCATCAAGCATAATGGACACTTGGCCTTCCAGCAGGAAAAAAAGCCCAGCCGCATAATCTCCGCGGCGG
TAGATAATTTCCCCCTGTCCGTACAAGACAAACTTTATGTTATCCAGGAAAATTTCTTCTAACTGCTCCAGTATTGTCGGCCTAGAAGTTTCGGGCTTTG
GTGACCCGACCTCACCGCTACTGATAGTATCTGTAGTCACAACCGATGCCTCACATACCAGCTCCAATGACTCGATCGCAGGCGTGCAAATGCTGCGCAC
AACGTCCCGCTTAATAGTGCCAGGGAGGTCCTGTAACAGTTCATCGATAATAGCACCACGATGCGCAGACCACCAGAAATCCAGAAACGAGTTCACTCGA
AGGTGAATTGAAAGTGGCGCATTTTGCCTCTTGAGAAAGCGTTGAATACCAGCACGTGCCGCGAAAAACTCTTTCTGCTCGAGGGCCGATGCAGTGAAGC
CTTTCTGTACATTATCCACAACGATGGCGGTAATGAAGAAGCCGCTCAACATGAAAATCAAAGCTGCACTGTACTCAGTATCGCTAGCAGGCTCAACCAT
GCGTCCAACAGCAGCTAAAACGTTCGCTGCGTAATAAAGTGACCGGAAATATTGTTCAGCACGTATTTCCTTGACATGAGTGCTGTCACTGGCGAGAATG
GTACCGGAGATTGTCTGAAAATGCGTCTCGTTCAGCCGCTGGAGGTACACGTCTTCAGACGGTAGCCATTGGTTTTCTCCAGCGCTGAAGCCATCAAGAT
ATGTAGTGCTGAAATACAAGCACGCGACGACATGGTACAGCATTAAGAACAGGACCCCAAGCATCATCAGCCTGTGCCGGCTATTTAGCCGGAAAAaagc
ttcaacttcacccACATGGCCGCGAAGTTGATATCCACTGATAAGCCTTGATATTCGCAGTGCTGGATGGACAAACTTGCTTGGCACAAATATCCAGTAG
GGCCACACACAGCATAGGTCAAGTAAAAACCTCCCACTCGACACGTAGCGTTCGGCAGTTCTCACTGGGTCCAAAATCTTTTCAGAGTTAACAGTGAAGG
AAAGGTGTAGGCTCCCATAGATGTCAACCCAGAGCACGACATCAGCCAGGATATTCATCGTGGTAATATACCAACTCGTCCAGAGCCCTTCGAGAGCTGA
AAATGAAAGCAGCAGGGGGATAATGACCCAGTTGTAGCAGTTTACAATGGAAACCACAGCTATCCACACCATCCGCTCATTCGACTCAGCGTCCCACCCG
CGCCACATGAGCAGGTGGCGCCACCAGCATATCCGCGGTGCTGAAGGTGTTGAAAGATGAGCGAACTGTTGATAGAAACCCTGAATTGCATCCGACGGCT
TGATCGCGTTGTCATGAAAAAAGTTTTCTCGTAGGAGCGAAAGCCTGTTGATTCCGCTGGCGAGAATTGAAATACGCCGGAAACTATTCCGTTGTGGTGa
tgccgctgccgctgttgGTTGTGAAAGGTTACCATTAACGCCGAAAGCTACCAACGGTACAACAGGAAAAATCTTGGTTGTGCTATCTCGTGACTTGCTA
TCCGACTGCCTTCTTGATTCCAGCCGGTCATTACTTAGAAATCGTGGCCTTGACGACCGCGGAATAAGACGAGGTTCAGGTGCCACACGCGATGCAAGCA
GGGGTAAACGAAGTACTTGATCGGGTTGGGGACAAGGACTCGTAGCTATTGCTTCGCTTTGGCTCGACACAGTGAGGCTATCCTCTCTTGATGATTCTGG
CGCCAATTGAGAGCTGCTGGTATGCTTAGCTAAGGCGCGTGCACGCAGAATCTGTACGAACGACGATACCAGTTTGTTCTTAGTGTCTTCAACAGCTTGA
TTGGGTCGAGCATTGTTCGCAAGAACAACTCCATCGCcagatggtgctgctctcAAAGGAGAATTCTCGGCGACATTACTTTGCTGAAACATTTCTGCAA
TCGTACGGAGAATTTGCTGGGCATATCGTGGATAACCCTCCAGAAGTTTGTCAGCATGAGCGCGAGAAAGCTGATACAGCGTGCAATACGTAGCAGTGAC
GACGGTAGCTGTCCGAGGCTGACGAGAAAACACAGCGACCTCTCCAACAAAATCTCCCTTACGCAACTCGCGTACTTTGACTCCACTCACAACGGTGTGC
AACACACCTGCATGAATGATATACATAGCGTCCCCATGATCACCCGCACGAAAGAGAGCAACACGAGCCGGCAACGCAACCAGCTCTAGTAGACGGGTCA
CAGCGCGAATAAAGAGGCTGTCGCATCCAGAAAAAACAGGCACGAGCGCGACAGTCGCTTCAAGGAGCTCCACCTGAATGTCCACTGATATTGAAGGGCA
AAGCCTGTGGGCAGCTTCACGGTCATTAGCCTCAACTTGTGTAtggtgacgctggagatAGTCAACCGCTTGAGTCTGTAGCTGGATTGGAACCCTGTGG
AATGCTAAAATATGCTGGAACTGGTTTACACGCGCCTCAGCCAGTTCGgcatcaccaccttcgcATTTAGACAGCAGAAAGAAGGTCGCACATAGTGATG
TGAATAGAGAAAACCCGCAAAGTCCCACAACAATCGTGAACGCAAACTGGGCGTTGGTATAGGGAAGCTCGCCCTCAAATCCGCCAGTGAGTACACCGAA
CGCCCAGAAGAGCGACATGAGATACTGCCGTCTCGAAGTATGATGTTCGCCATGCGGTTCATGAGGTAACCAATGGTTTGGTTCCTCTCCGGGGTGTGGA
TGGTCGTAGCCGAAGCTAAACCGCCCGCACGCCACAAAATGTGACAAAATCAATGTGAACCCCAGCACCTTGGTGAGTTTGAGCGCAGCAAAATGGCGAG
CGTAGAGGTCATCAAGGTTGGAGGTTAGAGCTGGCAAACGCCACATACGCAGGAGTTTGTGCAGCTCGAATAACGCCATTGAGTGTCCTTCCGTCACGGT
GGCAGGCAACACCAGCGACAATGGCACAAGTGCCAACACGTCCATCAAGAAAGCAGGCGATGACAGATATTTCCGTCGAGCCTTTCGCGCATCGCGCAGC
ACGTTGCCATTCTCAAAGTATCCGGTATTCAGCTGCACGTATATGTCGGCGCAGAACAGGAGCTCACACACGTAGGCACCGATCAAATGGGAGCGTTTGG
CTTCAGGATGGAACGCTGCCAGGAACGGAATCGCCACCAGTTCGAAGAGAATAGCCGCGAgtcggagctgcagacataCTCGAATGAAGGTCGAACTGGG
GTCGAATGCGTTGTGGTTTTCGGTCAGCATGAGATCGGAGGAGCCCGCACGCATCCGCtgacgcagcaacagcgacaaaCCGCTCGGTGCTCGGGTCACC
GACGACCGCCGGCGGCTACGTCTGGAGGCCCGCAACGACGCCGGAGCCGGCGCCACGCGCATCATAGAGACTTCCAGTTGAAAATACGCAGCCAGAGTAA
ACAGGTTTTTTTTATAATGCCTGGCATGCCAACCGTTGTCCGTCACCGACATGAAACGGACCTCAGTGTCCTGGAAGCTCAGACTACCCATCTCAAGCTC
AGTCAGCAGACATACGAAGGATCACGGCAACTGCGACGAATAATACCGAAGCTTGAAGGATGACTTGGTCACTATGAGGTGCTCCTGCCTTGGCAGAAGT
AGCCCCCACAATCCAATTTGCCTTGAGGTACAGACCCTGACTCAAGCTACACTCCAGTGCTTAACCCGCGACCCATCGACTACTCGACTCGCCGGCCATA
CCACCTGCACGCCGAAGGTCGGTCGGCAGGCGATCTGACGCGAATCCGAAGGTTCATGGTGTACCTCACTAACAGTGACTATCTTGATATGACTGTGAAT
CGCGACGAGAACGCGTcctggaacaagttgcttctACTACAGGAGAAACTGCACGCTGTCGCCGTCGGCTGCCTGTATTGTGGCCAAGGCTGTACTAGTA
GTTTATGCTAGTGGTAAGTGGTTGTAGTTGTGCCTGCcgtgtggaggtggcaccaGGACAGCCAATAAACTCTGGCATTAACCCATCGAGTCCCCACTGG
GGACTCGATGGGTTAAGCTCAGTCCAATGCCTTGATGACCAGGATTACTGTCGTGGCTGTCTAATCTATCGCAGCACGAATGGCAAACGTGTGATAGTTA
GCACTTCTGATAGAAAACTTGTGATGAAAAAGCAAAACTGATAAGTTAACCGTTCTCTTAAGAGAGCACAACACTCCTAAAACTCGACCACGTCCGGGAG
CTCCGGCAGATTCATTAGCTTGGCCTCTGACTTGGCCACAAAAGGGGGTGGTGGGGGTGGGGAGGAAGATACACTGACGCCTATcgaggaggcagcagcg
cGTTCTTCCGGGGTCGGGAATTGCGGGCCGATCATCGCCTCGGCCGTGTATTCGCTGGACGGCGCAGGTTCAGGGCCTGCTGCCTTGCCGAAAGACCCCA
TCGCGCTCAGCCCAGCCACAAAGCCCAGATTCGGGCGCATATACGTAGGTTGCGGACCGACGGGCGCACCGTAGCTGTACGGAGTCGGGTATAGCGGTGG
GTAGGCACCAAACGTGGCCGCCAGACCATAGGCCGGCATGCTTTGTGGGGTAGATGGGTACGTAGGCACGAACGGGGGAGGGGCCACCTGGTACATTGGC
ATACCCTGTGACAGAGCATAAGCACTTTGCATCCCTTCAATGGTGACGGGAGCTGATGCAGGAGCCGGAACAGGGGCTGGAGCAactggagcaacaggag
caacaggagctggGATTGGAGTTTGCTCTGTCGCCATAGCCTCAGTCTGAACTGACGGAGAAGTTGATGTGGAAACTGGGGTAAGAGCTGtttctggagc
tgcag