Description :
From Genome Similarity Track
Location :
Scaffold_37:11827- 17525
Transcript NameFunction/comments
Physo_135233PREDICTED: similar to LReO_3

Sequence
5698 bases(100 bases per row)
TTGTCGGGCGGGATGTCCGGCTTCGTAGCTTTCACCTTCTCGCCGACGCCCACTTCGCGCGCTTCAGACACTGACGCTGCACACTCCCCCTTGGGCTCGC
CACCTTCGGCTGGCACCGTTCCCTTCGGACCAACCGTTTGACGCTCCACACCCTTCGGATCGACCGTTGGCGGCTCGAAAGCCGACTCCGGGATCACGGA
AGTGCACGCAATGACCGTTCCTTTCCGGATCCAGTACTCATCCGTAGACGCATTACAGACTTCGACGATGGCCTGGCCTTTCTCGACCGTGCACAACGAC
CGTGCCACGCACAGCGTCGGAGACAGACCCAAAGATCCTTCGACCAGAACGGTCGCCTTGTCGACGACGGCTCCCACGACACGAGTCATCACGAGAGCTT
GGCCACGCGGCGGCAACCGCACCGACGTCGCCATCGTCGTCATGTACGACTCCTGCACCATGGTGAAACCCAGCGTCAACACTTCGCCCGTACTCTTCAG
AGTCAACGTCCGTTCTGAAACGTCGATTACGGCACCGAATGCTCCTAGGGCATCAACACCCAGGATCGCATCGACGTGGAGACGGTCAGCAACCAACAAG
CTCATCGAGACTTCAACCGTTCCAAGACGGAGAGAGAGGGTAATCCAACCACGAATCCGCAACTTGTGCCCCGAGGAGCTCCTCACCAGGCCCTCGTACG
GTTCCAGCGGCTCGGACGACCGTCCTAAACGCTTCAGCACGCGTCGATCCACGAGACTTAGAGTAGCGCCAGTATCCGCTAGCATTTGAGACGGTAAGCA
GTCAATATAACCGCTCGAGAGAGCCTCAAAGTTGCCAACAGCACACACCACCCGGCGTCCGTCCTCAACAGCGCGATACACGTCACACTCATCTCCATCC
TCCTCACAGAGTCCAAATCCGTTGGGCAAGTTGACCGTGACAACTTCCACGAGACCGGTCCTTGGTAACGGTGTCCGAGCCGGAAGCTCGCACCTCTACG
TAATGAGAAATGTCCTCTTCACGCTCAGGGTAGAACTCCACGTCTCCCAGTACTTCGGCATACGGTTTGTACAACGACGAAAAGTCAAAGCAACCCTTCT
TCTCAGGCTGACGGCGACGGCGGCGCCTAGCACTAGGCGTCCTCGACCGTCCCGTACGGTCCCACAGTTTCGTCCACACTTGACCCGCGTTTTCCTCGAA
ATACGACTTGATACACGGTTCCAACCGTCTCCAGCAATCCCCCTTCCGACCATACTGCTCCACAACACGGTTGACGTGCTCGCGTTGCCGTTCCCAATCG
GGAGCAGGCACCTTGTCACGCAACGGGGGAACATCCACCGTTCCTCCTTCACCGTTCAGCACTTTTTGAGAACCGTTGTTTCGACCTCCGTAGTCTCTCG
CTTCTTTCAGCAACCGGAACACAGCTTGACGCGCGATCGCTCTCTTGATCTTCGGATCGACGCGATGCACTCCACTTAGGACAGGAATCCCTTCCTCCAC
CGAGACCGTTCCTCCCGGGTCATCGGGAGGGCGCAAGACATTCTCGCACACGAAAGACTCGACGACCGTGTTAACCACGCTTGTGACCGTTTCATCTTCA
GAATCCGATCGTTCGGAGGAGACATCAGAGCTGTGGATATCGTTGCCGACGCCAGACCGCTCCGAGGCCTTCCCCACCGTCCCACTTGACGCAGCTTGTT
CACCATATACGACATTCGCCACCGGAGTCCGGAAGTCTCGGTTCGCACGCTTGGCTTCCTCCGACTTATCCAGCATATCACCGTACCAATCTTGCCAGTA
CTCAGGCATTCCAAAGGAGTCGGAGGCAGCTTGGCGCGTCCGCTCCAAGACCTCCAGAGAGATACCCAAGAAGCGAGCCAGCTCTGCCGCAGACGGTTCG
GTCTGAGCTTTAGCGTTCTGCTCAACGCGCTTCATCAACTGGACCTCGTCCAGCGGATACAACCGGTCTTCAAGCTCCTTGTCGTACTCTTCTGGCACGG
TGGCGACATCCGTTCCAGCGAGAACATACGTCTCCTGCCCGGGCTCACAGTCATCCATAGCATCCAGTTCTTCGTCCGTAAACAAACGGTCGTACTTCGA
GGAGTCCTTGGCCTCAACCGTTTCGTTTTCGACCGTCCTGGCCTCGACCGTACCGTCCACTTCCTTGCTCTCAGCAAGAACGGTCTCTTCATCCGTCCAA
GCCGCGAATAAGCAGTCCGATACGTCGTACTCTTCGTCTCCCCACACTTCTAGGGGCGCCACCACTTCTTCCGGCGGCGTCACTTCAACCACGGCACTTC
GTTCTTCACGCATCACAGTAGGAGGCTCCGACACAGTGCAATCCTCGGACAGCCCCGTGACCGTTGTCTCCCCACCGGTCCCAACCTCATCACACCGTTC
GGGACTCGCAGCGACCAGATCTTCGTAGACCACTTCGACTTCCTTGCCTTCGACGTCCGCAACCAATCCTTCTCTTTCTTCATCCGTCCCCACGATCTCG
AACCCGACTTTCTTTTTCTTGTTTTTCTTTTCAGCACATGGAGCTCCACGCATGGCAGACACCGGTTCGGTCTGCTTCCTCGATGCATTCACACAAACAT
CAACGGTGGTCACCGTTCCGCCTTCCGCTTCACGGTCGCGATCACCACCACTCGAGCCATTTACTAGACAAGAGGAAGGAGTGACTCTCTCCTCCCCTTC
CTCCCACCCCCGTCATTGGTTCGAAGCGGTTTGTGCAGACTTGGTCCTCAGATCCTGGGCCGCACCCCGGAGTGCCGCAATGCCAGGACACGCACCGATA
AGGTGACCTTCTTCCTCGCAGAACGCACACTTGGTAACGCCACGGCCACCGTTCCGGCCGACCGTTCCAGGGCCGCGTTGGTAGTTGTTAGGTCCTGCTT
CACACTCCACAGCGATATGACCGTGAACACCACAGTTGTGGCACGTCATGGACTGGCGACGGAAGGTCTCTCGCGAGTGACCCACGTAGCCACACCGGCC
ACACACAGGCGCTCCCTCTTGAGCTCGACTGTCAGCTCCCATACGGATTCCTCGGACCGGTCGACCGTTCCCACGAGGACCTTGACCGTTCATTCCAGCG
CCAGGACTCGAAGTCGTAGCCGAAACGTTGGGCATGCGGTTCCGCGGCGAGCGCGGAGGCTGCCAGCGGTTCTGCATCATCTGCTGCTGCCACTGCTGCG
TCATGAACGTCGTCATCTTCTCCGCGAGCACGCCCACAGCCGCCATCGGATCGTTCGCGGGCGAGGCATCGCTCCCGCTCGACTTCCTCTTCTCGTCCGA
GAACTCGTCGTCTTCTTCAATGGGACGTGACATCTCCTTGGCCAATAGCCATTCGCAGGCCTCCGGAATGTCACGCGCCGGTCCCGAGTCGAGACATGCC
AATATGCGCTTGTTTCGGAGCCCGCGACGGAACAGCTGATATCTCATCTTCCTGTTCGGATAGTCCAACGAGTCACAAAGATCCGTCACACGGTCACCTC
ACTCCTCAACGGATTCGCCACGCTCACGGTGAGCGGACTGCAACCGTTCCCAGAGCTGGTCAGCCGTTCGGCTGAGGAACAGGTTGTGGAATCGGACCTT
CAGAGTCGCGAACGTCTTGATAGTCGAGTTGTTCCACCACCATTCAGCTTCAGAGCCCTTGATCCGTTGTCGGAACACTAACAGCCGAGACTGGTCCGGG
AGGTGGCTGGTGTGAGCTTCGAACAGCTCCCAGAAGTCACGCGCCTTGTCCATGCTGGCCGTGTCCGAGTAGAAAGCAGGTAGGACCTTGATCGCATTGG
AGACCATAGACGACAAGCCACGGTCGTTCCGAACGGTCGGGTTGTTCATGGGGGCACGGTAGCCACCGTTCCGAGCTTGGGTAGGCATCGGCCGTCCGTT
CGTTGAGGCACTTACCGCAGTTCTGACAGGTGCTTTGTAGTGCACGACTGTCTTCACCGGTCCCGTCGGTTGGGTCTTCACCGGTCTCGTAGGTTGGGAC
TTCACTGTAGGCTCCACTTTCACCTTCCGCTCCATCTTCACCGTGGGCTTCGGCACCGTTCCCCAACCACCGTAGCCTCCTTGCGGGGCACCGACGCTCC
AGCCAAACACAGGACCTCCAGGCAGACGCTTCTCCGTTCCCGTGTACACCGGGATGAAGCCACTTGGGGTCCTCTGCTGCCGCACTTCTTCAGGTTCTTC
TTTCACGTAGTCCGTGTAGTAGGACGGTTCGTACTCAGCGAGTTCACTGTAGCCGTAGTCTTCCGCCGACCAGTACTGTTCCGTTTCATCAAGTCGTCAT
CCTCACCGTCTTCCTCGACCGTTTGCACAGCCTCGGGGCCCGGCGATGGAGCCATCTTCATCTCGAGCTCTTGTTCTGCTTGAGCTCCGCCCGCATCACC
GTGTTCATCTGCGGTCTTGTGTTCATCATCGTCTTCATCGGCCCAAAGAGCCTCCCTCGTTTCCTGGCGAAGCGAGTCACGACCGGCAGCAGTAGCTACC
TGCGCCGCCGCGTCCACTCCGCTCGCATCTCCGGACGATCGCGGGCGTCGCTGCCCCAGTAGAGCCGACGTGGTTCCACCGAGTTGCAGCCGTCGCAACC
GTTCCGCTTCCAACCGTGCCACTTCATCTTGCACGGACCGCTGATTCCCATTCTCTCCTTGCTCTCCAACAACCGTCATCTTCTTCAGAAAGTCTTCTTC
ACTCGACCTTCAGCACGCGATCTTCTTCACTCGAACGCGCGAAACAAACTCCAATCTCCAATCTCCAAACTTCAAACTTCCAGACTTCAAACTACTTCAG
GCTCCGAGCGAGCCGACCAGAATTACCGGCGGAACATAGCGTTCCGTTCACCGTTGACTTGACCTTGACCGTTAAGGGCTCCGAGCGAGCCGACCGTTTT
CTTCTTGACCTTCTTGACCTTGACCAATGGGGGTACTTCGCGTACCGTTCTCCAATCCCACAGCGGCGCCGAGCGCACCGTTCACACGACACAATTCCAG
ATCCAGACCGTTCACGCGCCCGAGGCGAAGACTGGGACTCCAGGCAGACTCCCGAAGACCAGACGAAGCTCCACCGACGCGAGGACTTGACCCGTACTGC
CGTCGTTCAGACTTCACAACGAAGACCGTACCCTGCTTCTCCACCACGTGTCGCGAGTGCCCTGGATGGGACGGTCAAGCGTTGTATGGAAGCTAGAACG
GTTAGGCAGTGGCACAAATAGCGAGACCAGAGCTAATATGCAAAAGCAATCAACTTGTTCTCTCCAGTGCAGATTCACGACTGACCCTACTTCCTTACCG
CGCACGGAGCCTGACAGCTCGTGCTTCCTTCTTCTTTCGGCTCTCTGTCAGCTCACGTGCCGACTTCAACACGTCACCGGCTCACCTGGCTCTCGTCTCA
CCCCTTCGTCCTTGGCTCACCTCACAGCTCATGTCCTGAGCCACGCGGTGCTCGTGACCTCCGTCCTGCCCTTCGCGTCACTGCTCACCCATCGCTCGCG
TCACTGCTTCCATCGCAGCCGCTCGCGTCACTGCTTCCATCGCAGCCGAGCGCGCCACCTAACCGAGGCGTCGCCAGCCAGCACCCCTCCGAAGTGGATG
ACTGCCCGCTCACCGCATCGTCCCACAGCTGATCCTCCAGAAGTCGATCGTTGGTCGAACGGTCGTCCGTGTAGTAGGAACGGTGGTGACCGTTCCTA