Description :
From Genome Similarity Track
Location :
Scaffold_2:11827- 27017
Sequence
15190 bases(100 bases per row)
CAGTTCTCCCGTCGGTTGTATATGAAAATCTGGATGGCGACAGAACGGCGACTCTCATAACTCCGAGCGCTGGCGTGCTCGTGGCACATGTAAACTACAG
AACGGTAAACAACACAGCTGATGCTGGTCAACAATAACGGCATACGGAGACTAACAATTTGAATATCACTACTACCAATTGCAGGATTCGCGATACTACA
CCGAGAATGTGCTTGAATCCAGGCTCAACTACCCAAGTACGTTGTACATCATTGCAGCATCTCCATTTTAGTACCAAACTTATGCGTTGTGCCGTATTTC
CCATGTGAAGCTTCTCTCAGCCCGTATGTGAAGATTTCGTATGCTTCTAAGGCCTTCCCGTCAACAGCGTACAAAGCTGGTGAAGGAGCAACTTTTCAAA
AAGATtttgacgctgctgctgcacccgtTGAAAGTGACGGGTTCTGCGAGCGGGAGCTGTCTGCCCTGCGGCCTCTACTTAACACTCAAAATGACTTATG
CGGCAGGTTCAAGCAGGTGGATACCAATGTGGGGTTTCTCTTCCAGGTGGAATTTGTGGAGCCTAGTCCCGTCACTACAACCTGGTCGTGGTACCTGGGA
TTGCCTTTTCGACTTGGTAATGGTGCCGTGATTGTTCTTGATGGATCTATTGTGCGAGACTTGATGGGGAAAACAGGATACTGGAAAAGTGTCCTGTCGA
AAGCAACCCAAGTGGACATGAAAGTCACACCTGGATTTCATGTGCTGAAGATTTACGGACTCTCAGCCAAGTTCGAAACGTCAGCGGTGTACTTTAGTCG
GGATGGGTCTACACCAGCAATTGCTTCCGTTTCAGGTATTGTTGCAGAGGTAACAAAATGGTCCCCGTTCGTCGCTCCTGATTCTACGACATCGGCCATA
CTTACTACTGAACAAGCAAATAAAGCGAGCAGCGTCGGAAGAGGAGTCTCAGTTTTGCAGTTTCAAAATGCCACGGTTGATGGGCGGATCGCATTGCACC
TTGGATCGGTGTCTTCAACCGATGCCGAAAGCGCCAAGACTAATACATCATCGCTAGTGTCGTTTGCCTTTCTACCGACCACCGCATGGGGCACTGCTCG
GGCGACCCAAGTGAACTTCCCGACAGCAATCACTACACAATGGAGTGCGATACCTGGATTAACATTTTCTCTTCCGTATTCATCAAGTGGAGTTTTGCTT
TGCTCGTTTACGGGAAGATTCTTGGTGGACAAGAGCATGGTAAAGACCTTTCGCCTGGATCTTGGGTTTGGATCAAGCTCTGTATCACCGGTGTCGCAAT
TTGGCTTAGACGACACGTTCTTGGATCCATCTGGAGTACCGCTTGACTTTTCTTACTTCACCagtgcttcttcagcaagtgCACTGAATCTTTCGCTGAG
CTATCAGTACCAAGGAACGAAAACAGGAAAGATCATTGGCGGTAGAACTACGGCTGTATTCATTCCAGGGGCTTCGCTGACCACCGATTCAATTGGTGAC
AATACAGTTTCCCTGGCGACCACAGTCTTCTCGAAACTAATAGTTATTTCTTCCTCAAGTACTCTCGTTATACGTGTTGCTGGTATTATTTGCCGCAAAT
CAGCTTCCGAGACTTTTCGTGCACGGATATCAAAAAATGGAGATCCAGTTTTTGATGGGGACTTCTCTTCGATCTCTGGGACAGTTGCAAATGGAACCTG
TGAACCATTGACAATGCATTCTGTCGTTGATGCCGTCCCTGGTTCGCATACCATTGCGATTAATGCAAAAACGTCAACTACTGCAGGCTTCCAACTAAAA
GGAGTTCAGTTGCAAATTGCCACCATCGAACGAGGTGCGTTGCTTTCACAGGAACTATGTCAGTCTCGCTGCACACGACATGGTCTCTGTAGACTAGGTG
TGTACAACACTGCGACGAGCACGTGCAACCTATATATGCTTCGCAACTCATCATCCTTGACGACAGATTCAACGAGGTTGACTTATGTACGACATCAAGA
ATCGACCATTTCAGAAAATGCGTGGACAATTATTCGTAACACCAAGTGGTCTCTTAGTCAGAATGCCTCTATGCAGGCGCAATGCAAAGGAAACACATGT
GGAGCCAACGTGTGTTCTGAAATGTACACGCTGAAAGATCGCTGTCGATGCATTTGCCATTCTACCAACGATTGTGTTGGTTTTATGAACACAGATGGAA
CATGCTATGGGATTACCGCTGCGGACCTTCGTCAAAACATGCAAGCAGGAACATACAATGCTTCAGGTGGAAGCACAGTTCACCTGAATATGCCCTCGAC
TTGTCATGCAATCAAGACCGACGCGTCAAATGCAATGAGTGGGCGCTATGGTATTGCTACCACTACAGGAATCTTTAATGCATTTTGCAACATGACGGCT
GATAGCGGTGAGGGATATACGATTATTCCGTGTGACATGGGTACCAGCGATATTGAGTGTCGTAGCAGCACTGGTCCAAAAGACAGTGATACCTGTAAGG
CATTGGGTCTCCGACAGGTTGTACCGCGCTCGTCAGGTCATCTAGTATCTATGCACCGAAAATTTGGCTCATTATTTTTCTCCACTGTTCCTGGAGTAAC
AAATGCTTACGTTGGCGATACTGTGAATTTGCCAAGTGATGAAGATACTGTGTTGGATTGGACAGCAATTGATGGCGGAAAGTGGTGGTTGCGTGATAAT
GGAAGCAGCTGCGATATAGTCTCCCCTGCAAACGCACCTGACGAAAAAAGATGGCTAGGGATGCATTCTACTTCCAATGGACAAAACGTTCTAGATGATT
TAGGTTTAAGTTTCGATCCGCGTGGTTTGGCAACGACAAAATATCTGTGCTCAACAAATGATATAAGCCCTTCCGCATCGTGGAGCTTCGCTCTTCAAGA
CTCATTTATTGGATCTGGCGACGACAATTTGTGGGTGACGTCATGGAACGGTACAGACAAATGGCACCAACTTTGTCAGGGGATCGTGATTCTCGGTGGC
AAGTCATTTACGCGGACCAGCTCTTATGTTAATAAGACGGTGGCCCAGATCAATAAGAGTGACCAACCTACGAATGTGCGCGTCAAGTTTACGTACTACT
TTGTATTTGACCCCCTCTATTGGATCACACTTCTTCTCAAGAGCTCCGAGCCAAAGACTATTCGTGTTTTTCTCGGTTCCCAGCTGATTCGACAAGTTCA
AGTTGACACATCGGTAACATACGCATGTTATGGACAGAATTCTAACTCGCCCCAACAAGCTTACTTTTATCGTGGACGGGAGCGTTTTGTTGTGAGAGGC
TTCAGCGGAAGTGCGACGCAACTTCGGTTTGAAATTGATTTTGGATCGTTGAGCATAAGCGCTTTTGGGATTGATGAGGTGTCAATGGAGGTTGAATCTT
CTTTCAAGACATCACTAGGATTATCGATGGCAAATCCAGCAGTATCGTGTATGCATCTAAAAAACGAGCGACTATTAAATGGAGATCAAAATCCAGACGG
GCAGTACTATATTCAGCTCGATTCAAACGTTGACCCTTTAAGTCTTCCATGTTCCGATGGCTGGATAGTTGCACAACGTCGCATCAATGGGAAAACAAAT
TTCAATCGCAATTGGAATGAATACCGCGATGGATTTGGGCTGGGATCCTTCAGTGAATGGTGGATAGGAAACAATGTCATTGCAGCCATCACAGTGCGAG
CTACCGAGGCAATGGTCGTGACATCAAAAGACTATCAGTCTCAGGCTGCGACGTATAACGACTTCCGAGTTGCTGGGGAAAACGAAAAGTACCTCCTGAC
AGCTCGGGGATACGTTTCAAAAGCAACTTCTGCCACAGATGCCCTAAGCCCCCTTTCGAATACGTATTTCAGCACACCAGATCAGGACAACGACTTGACT
CCGAGCCAAAACTGTGCCAAGAAAAGTCGGAGTGGGTTCTGGTATGCTGACTGCCTCAGCTCCACTAGATCTGACCTAAATGCGCCATTTGATGTGCTTC
CAATTTGTACTTCCTACTCTGCATGGGCGCAAAGTTGGTGCCAGAAGACGGGAAGCATAGTATGGAATAATGTGGATGGCTACGGCTCCTCTACACTGTT
GTTACGACCGGACAGATGCGCTCCGGGCTCCATTAGCTCCGACACTGGAGAATGTTCGCAGTGTTCTGCAGGCACGTATTCTATGCCACACTCACAGGCT
TGTGTTGCCTGTCCTGCTGGCACCTACGGACCCTCTGTTGGTGCGTCTGATGTTGGAGCTTGCCTTCCATGTCCGACGGGTTTCAAGTGCTCAAGTAGTT
CAAGAGCGCCAGTGAAATGTCTAGCAGGTACATTTGCTGACTCTGGGTCAAGCGAATGCCTAAATGTACCAGAAGGGTATGCAGGTCCGTTCGATCAAAT
GTCCCGAGCCGATTTTATAGCGTGCACGAATGGAACATTCTCAAAGCCTGGGCAACAAAGTTGCAGTGCTGTACCAGCTGGATTCTACTGTTCGCAAAGC
GACGTTGTTTGTGGTTACACTTCGTTAGCTCCATGCCCCTCCAGAACCGTGTACTGCCCAGAAGGGAATTCTGGCCCAATTATCGCACCACCTGGTTATT
ACTCCGTGGGCTCATTGTTAAATGCGCAGCATTCCGCAGTACTGCCCTGTCCGAGAGGATTCTACTGCCGGAGAGGCGCAATGTATCAATGTCCCCCTAC
ACGATTCGGGGACCAAGAAGGTCTCATTAACCCGCTTTGTTCTGGTCGATGCGCTATTGGGTGTGTGTGCAAGGCTGGGAGCATCAGTAGATGCCCAGAT
GCTCCAAGTGGTCTTAGTCAAGTCGCATTGTCACCGGCATCCATTTCATACGTACTTGCACCTTTATCGAAGCAGCCCGGTGATTCCGACGACTCACTTT
CCCAAGGTGTTATTTCTGCTACAGGCAGCGGGACAGTTGCATCACTTGATGTTTTTGAATTTAGAGACGTCAATTTGACGTTGTTTAAGACGGGATGGAC
TTCAGGGTTTGCGCACAACATTTCAATTTCGTATTTCGAGCAGTCTCAGATTGACCAGAAATACGACTTTCAAGTGCCAATCGCTGGCTTCGATTGGGGC
GCCATCGTAGTGTTGGATGGAAATGTTGTGGTTCCTCGATCAAAAAATGGCTCTCTCGTTTTTTCATTGGTGTCGACTTGGGGTCAACATCGAATATCCA
TCGTCGCAGCTGAGTCACAGTTTGTGGTTAAAAGATCTATCCTCTTCAGAAAAACATCTGACACAAGTTTTAGCAGTTTACGATGTGATCGGTTGGATGG
ACAAGCTATCTCGCTACAAATTGATATCGCTTTGTGCGGCACTGCGACTACGGCTTGCAAAGGTGCCGCGAACATTAACGGAGAAGTTGCGAAAAACCTT
GCTCAAAGCACAAATTCCTTGGAGATGTTGGTGTATTCAGGAACGGGCGTTCAAAGGTCTTATTTAATTGCTAACATATCTTCCCCTGCCAGTTACATGC
CCACATTATCTGCGATGGAGGCTGGTGGAATTGCTATTGTTATTGGCACAAACCTGGGAGCGTTCCCGTCGATTTTACGAACCTGGATAACAGGGTTTGG
CATACATCAGACTGCAATTGATTCCGCATCCTCTGGCTTTGCTTTTGTCGCGGTCAATGATAATGCCACACCAGTCACTTTCGATGTAGTTGCATCGGGA
TTGAGTTACAACTTACAGTTGGCTCTTCCCCTCTCACAAGCGATCTCATACTACAGTTTTACCAATGTCCCAGCGGGCTATTATGCACTGCCTGAGGACG
CCTCAAATGGTCGGCGGAACGAACTTAAAAAATGTTCACCGGGATATAGTTGCTCAGGTGGTACCCGCACACTGTCTTTCGTCTTTCCTGGGCCGATTTG
TGTGGACAGAAAACACTCTTTCAACGTTGACGAAAATAACGCTAGTTTTGTTTCTAGCATTAGTTTTAATCTCGTTACCTCTCCTGCTGGTCTGACATAC
CAACTCGAAGCTCCCATCGCAAGTTTATTTGCACTGGATGACCAAAATCATGTAAAGCTTCTAAAGGCGTTAGATTATGAAGCACGGAATGCCTACGATT
TGACCCTACTTGTTAAAGAAGCCCAAGCAAATGTGCCGTATGCAGCATGCCACATTCGCGTGAACGTGGTGGACATCAATGAAGCTCCTATCGTGATCAA
TTATCAAGCTTCTCGCACAATTAAGGAGAATTCTCTACCCCCCGTCTCGATTAAACCTATTTTAGATGTTGTTGATCCTGATACGTACGATTCTTACACA
TTATCAATTGCTAGTGGTGGAAATGACACTTTCGTCGTCAGCCGAGACGGGTCAATTGTTGCAACTAAGTTAATTGACTTCGAAAAAACACCCCAATTCG
TATTGGATGTTGTTGCCAAAGATTTAGGTGGATTGGAAGGCCATGCTAGCGTTGTGATTGGTGTTCAAGATGTTCCGGAGCCTCCAATTTGTGCGTCATT
TACGTTTAGCGTTGCAGAAAATACAACGGTGGGGACAGTTATCGGAAACATGAGTGATTATGCTTCGGACTCAGATGCAGGTGATCGTATAGCGTACGAC
CTCTTTTCTCAAAGTGTTCTAGGAACTCTGACTATCGACTCAACAACTGGCAGTGTGACTTTAAGAAAAACGCTTGACTTCGAAGGTCAGGATACTATTC
TCTTTAAAGTTCGTTTTACGGATAACACAAGTCTTCAAGTTACGTGTGATTACACTATTGCTATCATAGATTGCAACGATGCTCCTGTTTTAACGAGTGC
TGTTTTTAGTGTTCCAGAAAACTGTGTCGGAAATGATTGTTTGGTTGACAATCTGGTTAAATATGCGTTTGACGAGGATAAAGTTTCGGTTCTCACGTTT
GCTTTGGTATCCGGCAGCGATATGTTTTCTATCCAAGGCTCTCAGTTATGGGCAATCGGGAGTATGGACTTTGAAAAGGCCCCCGACTTTAACATCAGCG
TTTCTGTTGTCGATGAAAGGGGTGGTCATGATAAGAATTCCATGAGAATCCATGTTGTTGACGTAAATGAGGCCCCTACCAGCTCGGTTTTTACTAAACA
CATTTTAGAAAATGTTCCTATCGGAACTATTGTCCACACATTTGAAGCTAATGATCCAGAGGGGGATAACCTTGTGTTTACTGTCGTGCATGCAGCTACT
GGATTTTTAAATTTGTTTGAGATCACAGGTGGAAAGCTGGTGACAAAATCTGAGATTGATTACGAAGCCATGTCAGCTCACTCGTTTGATGTTAACATCA
GCGTTTGCGATCCATTGAAACTGTGCACTGAGGTTGGTCCGAACACTATCGAGATTTTGGATGGCCCAGACGCGCCTGTGATCGAAACACCAGCAACGAG
TGTCTCTATATCAGAAAACGCAAGGATTGGATCAGCTTTGGATGCGAGTTTTACATTTTCGGACGAGGATGCTGGACAAGCTACAGATCTTATATACTCG
CTACACTCTGGCGATCCACAGAACCAATTCGCAATTTCCAAATCAACAGGTGCGTTGACAGTTAGCTCCTCATTAAATGCCGAAGTTGTGAGCAAGTACA
CTTTGGTAGTGCAAGCTACTGATGCAGACGGGTTGAGTGGGTTTTCGAGACCTATAACAATTGCCGTGGAAATGGTACCTTCACCACCTTTTTTCGTTGG
AGTCATTACTTCGGGGACCAGTTACAATGTTGACATCAGCCAGCAGGGTGATGGATCGTACGCGCCCGTCTCGTTGCCCATAGGTGACAGAGATCCAGGA
CAGATTGGTGGGGCCTGTTCGATCACCACAGCGACTGATAATTTTTCAATCATTACAACCAGTGACGGAACCGCGTGTGAGATGTCGGTTCGCCCCCGTG
TTTACGTTCCTGATAACGATCGAATCAGAGTTGTGCTGCGAGTGACGGATACGGTCGTGACTTCGTCGTACAGCGAGGTCACCGTTTATATTCTGTCACG
TAACATTAACCACCCTCCTACGTGCACCAGCGCAGAGGCACAACTGTTGGAGAACTCGCCATACGGTATTGTTGTTGGTACTATTACTGGAAGTGACAAA
GATGCTATTGATACTGTATCCTATTACATTGCTTCTGGAGATAACAATGACGTATTTCACATCAATTCTACGAGCGGCGTGGTTACGGTTGGTACCACAC
CACCCGATTACGAAATAAAGCGCCAACATACACTACGCATTCGCGttcaagacgacgctggagcccCTCTAACTGGTTTCTGTACCTTCACTGTTGATAT
TTTGAATGCATTGGAACCTCCTATTTGCGCTACAACAATATCCATTACCGTTTCTGAAAACAGTGCGATATATGATCCtgttggagatgctctcTGGAAG
AACTGCACTGACCCAGATACAGGCCTGGGTAATACTTCAGCATTCCTCTTTGATATTGTTGGCAGCAACCAGAAGTTCGCGGTGGACTTTATAACGGGCC
AGCTAAGAACAATCCAAGCTCTTGATTACGAGGAACAGGGAGTTTACAACATCATGCTTATAGCTCGGAATGCGTTTCAACCTGCGATGAGTACATTTAT
TGGCGTTAAAGTAGACGTGCTCGATCAAGATGACGCACCACAACTATCATTTCAGCCTGTTTTACCGAGCTCGACTCTGGACGGTGTCAATGTGCCAGAA
ACCGCTGTTGTTGGAACTTTGCTTGGCAATGTGGTTGTTTATGACGAAGATGTTCATGATATCTGCACGGTAGTATTGTTAGACTCGACGTCAACCTTCT
GCCTTAAACCAGTCAACTCTTCGGTGTATAATTTGGTTCTAGCGAAGCCGGTGGACTACGAGACACGTGGAATTTACCCACTTGAAATAACAGCGATGGA
TCTAGCCAAGGTGACAACAGCGATTTCCATTGACATTCGAATTATTGACGTCAACGAGGCGCCAACCTTTGAGGCTAATCAGCATTTCTTCATTGAAGAG
AACTCGGTTATGCGTACAATCGCAACATCCAGATTCCGACCGCGGGGTGCCTGCTCAATTGTTGATGATACAACGAGAATTATGTATCAAGCCAGTGTAT
CCTACGGAAATTGCCTACAGCTGTGTGCCCAAATGGACACATGTGAGGCAGGATTTTTCAACTATTCTTCCTCATTGTGCAGCTTACACAATGTGCTACC
GGACTCCTGTGAGCCACGCGAAAACTGCGAAAGCTTCGAAAGCATTGCTAACCACTCTGCGAACACAGCACTTTTGATCTCAAATGATACTCTGTTTGTT
CGACCATATAAGGCAATACCTGCGCCTGACGCTGACTTCACGCTGGAGTGCTGGATTGCTGTACAAGCTAACGAAGGATCTCTTGTGGCCTGGAGAGACA
AAAGCATATCCTCCACAGGGTTGCAGCTGGAATATGTAGGAGAAAACCTCCGAGTCACTCTGCACAGTGTTGTGATCAACACCAAAATCGTGTTCGTGGA
AGCGTTGTGGTATCACATCGCTGTAACCTACGACAGCAATCAAGGAGAGCTAAAAGTGTATTTGGACGGCGGGCTggttctccagcagcaaatcCAGTCT
CGTACTGGCATTAAGTGGGGCCCATCAGCCACACTTACGGTTGGCAACTGCGGTAATGACATCAACTGTCCGGCAAAATTTTTTAAGTTTTCCATCGACG
AGGTTTGTTATGTTCATTGTTTTTAATTTGATCAGCTCTCTCTCATATGGATTTTTGTGCATCTCCCAATTGTAAACAACAGCTGCGTTTGTGGAGGAAA
GCACATGCTTTCGAATTCATACGATCTAACTTCGGCCACTCCATCAACCCGAAAGAGACCAGTCTACTCGCCTACTTCAGGTTTAAATTAAAGCTTACCC
GGCCCATCCATCGCTAATCCCTGCATTATCTCTAATGTTGTTGTATTTGATTGACTTTATAGGTTTAACGATGATCTTCATGATGCTACACTAACAGGAA
GTGCTTTGACCACTTCGGGTGGCAATGCCCCTCATTTTGGAAATGCCCCCACGATAAGCGAATCGGTTGCAAGTACGGCGAAAAAATGGCGTCTGGCAGT
CTTGTCTGACAATATGGCATCATCATTTGGGATTGCTGAGATTGCCTGGTTTTCGGAGCGGAAAAGAGTTAACTTGACAACGGCACTTGCGACTGTAAAG
GCTTCGAATGGCTCCGATTTCCGCAACGCAATTGATGGCGACACGAGCACGGTCGCGTACATTGGTGCCGCTGACACCGATATATGGATCGAGCTTGAGT
TCATGATTCAAGTTGACGCATCTAAAGTGGTCCTCGATACGGACAGCAATCTGGAGTATTGTGTATCCGTCGTGGCAATTCAATACTGGGATTCCGATAA
TAAAGGCTGGCGAGTGGCATCATACCTTCGACACATCAACAAACCATCCTCGCGCTTTGTTTCGTATAGTAAGTTGTCCCACACAGTCTCTCATGCTTCG
GAAATAACATGCTAACTATGTATTttgaacagctccagcacagTATATACTTGCAGATGATGATGATACTGGTGGATCCAATCTAACGTATACCCTTAGA
AGTGCTGAATTTGCTTCTGTGTTTGAAGTCGATTCTTCGACGGGCTACATAAGAAGAAATACCTCTGCACTCGATTACGAGACCCAGAACCACTACGAGC
TACAAATTGGTGTCGAGGACAATGGCAACTTTCTCGCACTGACCACGGTGGCGATTTGGATTGTGGATGTGAACGAACCTCCAAAGCTGGTCGCTAATTC
TATACTACACGTGTCAGAAGCAGCGACTCTCGGTACAATAATCGGGACAATTAACTTGTATGACCCAGACAACGACGAACTTGCCGTGTCTATAGTCGGG
GGAAACGACCACGATACATTTTCCATCGAGATGAATTTGTTAGTGGTAGCTCACAATATATTGGATTACGAAACATATCCGACGTACACACTGCAGATCT
TCATTAAGGAGTTACGGAATGTGGGCCCGCTCTCTGCGTACGGATACCTAACACTTActgtcgacgacgaaaaTGAGGCTCCTGTGTGCCATAACCAGAC
AAGGAATGTGCCCGAAAATACTCTGGTTGGAACTCCAATTGGAAATATTCTTCAGGCTACCGATCCTGATTTTTATCAGAAAGTTTCGTTTGCTATCGTA
GATGGAAATGATGACAATTTCTTCGAGGTGGACTCGGTCACTGGCCAACTTAGTGTTGGTCAAGGCCCAGTGCAAAACTATTCTGGATGCTTTTCGCAGC
TTCGTGATGGGATGGCGGGATCATTCAGTACGTACGAGAGTGATACGCCATTCAAGGACTGCTACTATAAGTGCTTGTCGTTCCAATTCATGGCTCTAGG
CTTCGTTTCCGAGTGTCAGTGTGCTAATGTGGCCCCTGGTCTAGCGGAAAATAGACTCACACAGGCTGCGTGTGATCTAGTCTGCGACGATGCGCCAGGT
AAAAGTTGTGGAGGAACAAACCAGTACGCCATTTACCAGCTGGGAGCTCCATTGGACTTTGAGAAAGCGGATCGATACGTGCTAATACTAAGGGCACTTG
ATAACGGAAGTCCTGCACTCGCTACAGTGTTCAACGTAACAATCGATGTAACTGATGTTAATGAGCCTCCTACGCTGGCAACATCAGACGTCTATATTGA
CGAAGGAAGTGTGGCAAATGTAGACTTATCTAGTGTACTAGTTGTTGCAGATGAAGACATTAACGACACTTCCAAGGTAAGATTTGTCCGGTGTAATGGA
CTGGCGTGCCCATTTGACTATGATGCTACAAAAAGTCAATTGGTCGTTACGACAGCGCTAGACTACGAGCAAAAGAACTCCTATACGCTCACGTTTCGAG
TGACTGATAACGAAGCACTCACTGCTGACGCGAATATGACTGTTTTCGTTCGAGACGTGAATGAGCGTCCTATTATTTTTGATATGGACTTCAAGTTGCT
TGAAAATATGCCTAATGGTTCCCTTGTTGGGCTACCAGTTGCAGCGTATGACCCAGATCCAGGTGACAGCGTTGAATTCTCGATCGTTTCACAAAGTGTT
AATGGATGTTTGCAAGTTGGAGCACAATCTGGACAACTATCTGTGTCGAAAATGTCGTGCTTTGATTATGAGTCTCTCCTTTTTGACAACTTGGAAACGC
CTAGCTTTGCTGTTGCTACACTAACACATGGGGACGACCAGCTGAATATCACTGGCGCGAATTTCGTTGGGGAATCGAAAAACCATACCATTTTTGAGCT
AATGTACACGAGAAGTGCCACAGGGTCAGCTCAATTTTGGACATTACTACGGGAAGCACTGTTTGTACGTGTAGGTGTGTCGTGGAATGTATTTTATGCT
ATTAACACAacggaggagcaggtgaCTAGCAGCaatgctgtcgctggagcatTGACGTTTGAACTTCCACGCCTACGGACAGAGCACGTTCTTGATGTGA
AGTTCAGAAACACCGAGTGGTACCGAGTATTTGACGTGGCAAAACTAAAAAAAACGTTTAAAGTAGACGTTTCAGTGCAGGATTCGTCAGAGGAAGCACT
ATCTTCAACGAAAACGTTTGAAATTGAGATATTGAACCAAAACGAACTTCCTATCTTGTTACCCAATGGAGCACTTCAAGTGATTGAGAACCTTCCGATG
GGTACTGCTATTGAACCTGCAGTGGCtttgctgcttgatgatccAGAGGGGTCAACAAGTTTACAGTTTGTGTTGGTGAACCAAAGCATTCCAGGCTCTT
TTTATTTTGATTCATCAACTGGACACATGCACGTGGGAAGCCGAGGAGTGAACTTTGAAGGCAAAAATAGGCACTCACTTAACGTCACAGTTGTCGATGG
TGATATTTCCGCGAGTTACGTACTTGCAATACCAGTGGTAGATGCGAATGACCCACCGAATGCAACATGTGCTCATATCCATGTCAGTGAAAATGCGCCC
ATTAATACGCTGGTATCAGGAACCGTTGTTGTCACTGACGAAGATATGTATGACAAGGAGTTTACCTACCGCATTCAAAACGAAACAGAAACGTTTTCTG
TTGATAATGATGGTCGGTTAATTTTGAAACAGTTGCTTGACTATGAATCTCAGCGGTTTTATTTTGTTGCGGTGGAAGTCACTGATCACGGTGGTCTAAG
TGGAGACTGCGTGATAGTAGTAGAGATAATCGATGTCGACGAACAGCCGTATGGACCAACGTATTACAATGGTTCGGTATATCAAACAGCTCTCTTGAGG
CATCGGATACTGAAAATGGGAATGCTAGACCCCGAGAGAAAAGCACTTACGTTTTCAATTATCACGTCATCGGCTCACCAGGATAAGTTCGCGATTTCGG
ATGACCAGGTTCTGTATGTGAATAATTCTGATACCATTTCGGCTTCTGCccaagtgctgctgtcgaTTGAAGTGAGTGATGGGTTTAATCGTGTGCAAAT
ACTTTGTTTGCTTTCTATTCTGGCCGACCCGCCACCGATTCAATGTTTGGAAAAAATGCAACTCTTCTCGGTGGCAGAGAATGCGGTGGGAGCTACCGTT
GGCCAAGTTCAGTTCTTGCCGTTGTTGTATTCAGCAAAAGGATATGTCTTGCAAAACTTGTTGTTGCCGTTTACACTAAACACCTCAACTGGGGTGGTTA
TAGTTAATAATCTCCAGCCTCTTGACTTTGAGCGACAGTCCAACTATTCTCTAATATTCGCAATTTACTATTCCACAAAGGACTACATTATCTGCCCGAT
GACGATACGTGTACTCGACATCAATGAGCCTCCAAGGTGTACTGGTCAGTCAGCGGATATTCGTGAAAATCTTCTTGGACACGATGAATGGGTGCTGCAG
AGTGATGCTTTGGACCCTGAGGGAGACGCGTTAACTTTCATTATGAGCTCAAACGGCGTGCTTTATTCCAACGCGAGTGGCTCTGTTTTTGCAAACGACT
TGTCACTTGTCAATTACGAAGCAACGCCGTACTATGTGTTGACTATCTTGGTCAGTGACGGTGTGAACACTGTACAGTGCCCGATTACCGTAAATGTTAT
TGACACTAATGACTGCCCTCAAATACCGACACAGATTCGATATATCCACGAAAACAGTGCGATGGGTACATTTGTTGGAGGTGCTATTATAGCGCGAGAC
GAAGATTACAGTCTTTATCCAGGCGGAAGGatgtccttctccatctACTCGGATATCTTTATAATTGGAAAAACTTCGGGTATTTTGGTGGTTGCAAACT
CATCCAAACTCAACTATGAGATACTAAAACAAGTGGAAATTGTTGTTTACGCCACTGACGATGCAGCGGCGCCTTGTACGTCAAACGCTACGATTACGGT
ATTTATCGTAAATGAGAACGAGCCACCATCAATAGTGGTTGGTCTAGTCGGTTCAGTTCTTGAATTTACGAAAGCGTTATCCCAAGACCCATCTGTAGCT
GTCCTTAACGTGACGGCTCATGATCCTGACCAGAACGATAAACTTTGTTTCTCTCTCCTGAGTAGCAAAATCAGCTACCTTTTTAGGATCGACTCTGGAA
CTGGAGGAATCTTTGCTACCGATACGAGGGCATTTGATTTTGAGGCTCGCAACGTGTATCATCTTGATGTGACAGTGACAGATCTAGGTGGGCTGACAGA
CACACAGCAAGTGGAAATCCGTGTTGTGGATACGAATGAAGCCCCTACCTTCAAGATATTTCGCGTGAATATCAATGAAAATAGCCCCGAAAACACGGCA
ATCTTAAACTCTGCTGACCAAATCGCTAGTGACCCAGAAGGAGATGTTGTTGTGTACCATATCAACGGAACGGTAACATTTTTACCGTTCGCCTTCAAGG
ACAACCAACTTAAAGTGTCAAGTGCGCAGTTGGATTACGAAGTAAGGCCAGAGTATACCTTCCCGATACAGGCTTGTGATACAAGAGGACTCTGCAGCTA
TACTACTTTCACGATTATTGTCAATGACATAAATGAGCCACCATATATTTTCCCAACACAAATGAGTATTTCAGAAAACGCTCCGGGCAATGCGCTGGTA
GGCTCTCCAATCTTGGCCTCGGATCCTGATATTGGACAACGCTTGCTCTATGCACTTGCGGACGGGGATATGAATGATCTCTTTGGTATT