Description :
From Genome Similarity Track
Location :
contig_82:118266- 123363
Transcript NameFunction/comments
g10258.t1hypothetical protein
g10259.t1hypothetical protein PHYSODRAFT_329070
g10260.t1integrase putative

Sequence
5097 bases(100 bases per row)
AGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCATCGCTACGACACGTTCGA
GCTGCTCCACTTCGACATCTGCGGCCCATGGAAGAAGAGTCTCTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGG
GGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCA
CGACGGAGCTCGTGAGTTCGCGACCAACGCGCTGAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAAC
GGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGA
CGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCG
TGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTG
TCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTT
CGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCG
CAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTCCTCCTC
GCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACGACGACCCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTG
GAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGT
CGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGG
CTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTG
ACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGTCATGAAGGGGTGGTG
TTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGGTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGA
ACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGT
GCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGC
GGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTAGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGGGACGACATCCTGAAACGCTT
CGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAA
GCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAAC
ACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCCCAAGACGCATGCATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGC
GGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTG
TGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTGGCTATCCAAGAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGC
CACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGAC
ACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACT
TGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTAT
CGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTG
GGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAG
GTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCT
CGCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCACTCCGCTCCGTCAAGCTTCACGGTGTCAAGATC
CATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGA
CGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGA
CGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTT
GCGTGACGCGCCTGAAGACGCTGTACGGTGGTCGCAGAAGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAACG
TGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGACGAGGACGTGGCGATCTGCCTGTGCGCAGTC
TCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCGGAGCTGCGATCGCAAGACGTCGTGAAGGTGCTGACGAATGAGCACATCAA
GCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTG
GGGCACACGATCAACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATG
CCCAGTGGAGGAACGACGACGCCAACTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGA
TATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTT
TCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGAACCATCGTGGAACGAGTGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGA
ACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCG
CGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGATCCAGACGCCTCAGCGATCGGCGAATGCAGCGACC
AGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGATCGACAACGACATGATCAAGGACGCGAAGGCAC
CTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGCCTACGACACGT
TCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATG
AAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGC
GGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGAC
CAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCC
ATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAACCAAGTGTCAAGCACA