Description :
From Genome Similarity Track
Location :
contig_12:118257- 121197
Transcript NameFunction/comments
g3147.t1Pectate lyase
g3148.t1hypothetical protein PHMEG_00019424

Sequence
2940 bases(100 bases per row)
AGGTAGCGATGCTTTGAGGTCATGAGCAAAGGGTGTGAGCAGTGGACCTTGAATAAATACATCTCAATGCGACACCTTTGAGCGCGAGTGCACGCACCCT
CACAGAGCCCTTCTGGTCGTATGGCTCGACTAACTACCACCGAAGATCGACCGGGATATATTGTTAATACATGTGATAATGCATCGAGGTGGTCGAAGTT
GTGATTCAACATGCATCAATGACAACAACGACGGTTTGCATAAGATTTTTGCATACACACAGTGAGTTGCAGGACAACGTTGAGGCGCCCGCACTAGTTC
TCGCTCGCAATTTTTGAGAGCGAGCTGCGGTCGACGACAGGCAACACGATCGCGCCATGGACCTAGCAACGGTATCCGGTCGCTTTTACATGGCTGTACA
AAAGTAAACGAGATGCGTGCGTGGGTGTTGGTTTCCAGTAAACCACCTGCCTGTCAGGTTCCGTGTTGGCACTCAAGTTGTAGACATCTGGAACCGTTGG
AGATGGCATGAAGATGCCACGGAGACTGCTAATGTAGTGTGCAAACCTGGTGAAGATCGGAGCCCGTTCGACTAGTAGAACCGGATTCAGTAGTCGATTG
GATTTGCCATACAGAAAAACACTCCCAACATCCTTGTGACGGTGGATCGCGCACAGATGCTTTTCGGGCAAGCTCGGGAATCTACAGCAAGATGTCGTGA
GCGAAAGTGGTCAATCCGATCCGCCGATCGACGAAGCTCCTGTCAGAAGTAAGTTTGCGCTTTGTAGGCTTGACATCTCGCCGAACTGAGCGCTACAAAC
TCGACACTACAACATTGCCTTTGGTGCCGTCGTTGGAACCAATTCCACTGTGGGCGTACATAAATATCAATCGCTTTGCTGTTCGAGCATTTCCGTACAC
GTACCGGTCTCCCACGTGATTGTCGATCCCTGTCCCCCTCTTGGCTTAGAACTGCAAGCCCCTGCGCTTGTTTCTCTACCTGCTTCCTCTCTCATTCTGC
AACTTGCTTTCTACAACTCACACACCTCCACCAACACAAGACCAAGCCTACTACCCCATCATGGCTCGTACCATCTCACTCCTCTGCGCCGTGCTCGCCG
CCGCCGCTTCGGTCTCCTCGGCCTGGCCCACCAGCAAGGGCAGCGTCCGCTTCAACGGCGTCAAGATCATCAAGAAGGGGAGACCTTCGACGGCGGTATG
AAGACGTACCAGCGCTCCGACCTCAAGTGCCAGGGCCAGTCGGAGGGAGGCTGGCGCGACGCCGTCTTCAAGCTGGAGCCCGGAGCCAAGCTCAAGAACG
TCATCATCGGCCCCGACCAGCGCGAGGGCGTCCACTGCGAAGACAGCGACTGCACCGTCGAGAACGTGTGGTGGGAGGCTGTGTGCGAGGACGCGCTGAG
CATCAAGGGCGGTAACAAGAACAGCGTCACCAACGTGCTGGCGTGGCGCCAAGAACGCCGACGACAAGGTCATCCAGCACAACGGCTACGGCCACGTCAA
CATCAACGGCTTCTACGCCGAGAACTTCGGCAAGCTCTACCGCTCGTGCGGCACGTGCGGCAACATCAAGCGCACTGTGGCGCTGAACCACGTGTGGGGC
AACAACCCCAAGGTGAGTCTCGTGACCGTGAACGCCAACAACGGCGACGTGGCCACCTTCACCGACGACATCCACGTGCACTCGAGCAAGGGCGCCAACG
CGGTGTGCCAGACCACGACGTCCACGAACGGCAACGAGCCCAAGGTCACGAGCAAGGGGCCGTCCAAGAACTGCGTCTTCAACAAGGACAAGATCGAGTT
CTACTGAGCAGCGTTTGTTGGACTGCGCATTGTCTGGTTAGCGTAGTGTGTCTGCGTGCGAGAGTAGATGGCCGGCTGAAAGTTGAGTGCAATTGCCTAC
TTCCCTAAACTAAAATAAGCCTCGCATTATGATCTTTCTGCTATCGTCGCCACTTGCAGCACCAGTACATGTACTTGCTTTCGCCGGACATGCGTGGGTT
TCATACCTTAAACGATGATGTTTACCGCTTTGACAATGCGCTTCGTGATTGTCAACCAACGACAGAGCTTGATGCAGCGTCTAGTCTTGTGTTCCTGCGC
TGTGCATCGCTTGCTGACATCGGTACTCTATGCAAGTTACTTCGCCAGGTGGCTGCCATTCGTCGACAACTTGTTGATACGAAGATGTTACATGATGACT
AAAGAGAAAGAGACTCGCGACCAGCTGGCGAAGTAACCTGCGCGAATGACGTCGATAAATCAAGCGATGTAAAGTCTCGAGTGCTAGCGCAAGTCCATTC
TACGTAGTACAAAACGAAGAGCGTGCATTCCACGGTACTGGTGCTAATAAATATGTACGAAGGCCCTTACAGCAACTTGGTGTTGCGCTCAGCGAGTCGT
TGTCTCACCAGCTCGAAGACGCCATTGCGGCCGAAAATGCAGCAAATCTGGGAGCTCTTCTTGTGCAGCGCTTGTCTCTCCTGCTGCAGCGCGGTGAACC
GAGTCGTCAGTTGCTGGAGCTGCTGCTCGTGGCACGTGCGAGCGCCTCTCAGCACCTTGAGCATGTTCTCTCTTCGTCGCGCTCCTCGCCCATATTCATC
AGGGCCGACGCCGTATCCACCACAGCGGGCACGTTGCCAACCTCGAGCTCGCACACGAACTCGTCGATGGCCTCGATGCGGTCGCAGCAGTCGGCGATGT
CGTCGGTGTAGGTTTCCACCTCCTCGTGGTCGTCCTTAAGCGCCAGTGCCAAGTCATCCAGCTCGACGTCGATCTCGTGCACGCGCGCCACCGCGGCCTT
GAGCTCCAGTACCAGCGCTAAGTTGGTCACCGTTGCCAGTGGACGACTCATGTTCTGGTCCATTTGCTTCGCGTAGGGAAGAAGAATGCCTTGTCTTGCT
CGAGGAAAATCGGAGACTGAGACCAGCGGCACGTCTCGCG