Description :
From Genome Similarity Track
Location :
scaffold_9:118256- 127804
Transcript NameFunction/comments
Plaha_PHALS_14877hypothetical protein
Plaha_PHALS_02552hypothetical protein

Sequence
9548 bases(100 bases per row)
AGACAATAAAAATTGACGTTCTTTAAAGTTACAAGCTTGACCGGGAGCCGCGCTTGTATCTTCGTACCATGAAGCACTAGATGAATATTCAGGCGAGCAT
CTCTTTATTTAGTCTGGTATTTAGCAATCCACAAAATGGGTAAAGCAGCGAGCATTCTTTACCTAAttaccttacgttctatactagaaccccAAAAAGT
ATgttcgcggcttcacgggaagcacatccccaGTCCTCGGCACCTGGGCGCCatacaccgcgcccgccacggatGGCGGATTTCCGCGTCGAGGACTTGG
AGGtagtcgactacaagtcggGGACTCCTTTTCAGTATGGGATGAAGAAGGCAAGCTGCGCAGCTGCGCGACCTGAGTCATGCTTgagccttgcggacac
catgtccgttccccgatctctcgacttccgaggGAAATTGTACTATTAACAATCCCTCGATGAAgcacagcagcagcagttGAAGGTTGTTCAcaaggcg
gctctcatgcgcttgtATCCACATTtggtcctagaccctcgtgtagaatacggcttccgctcggcggatcccgctactgaagcgaaagacgcgatcactc
gatctttaggcgtctacgtagtcggttCCCtggtcactacacaagccgacCCagaaaaagctctccgatcTCGCATCTTGGTACCtagtagtgctcgccc
ctggcaaaaccactgcagatgatgagaagctctttgagcgatgggtgcagcggcattgAAATTTTTCTCGCTGTCTATCTTACAGCGAGcctcaaggaag
tggacgcgcGCGTAAAATGctatcttagatttgagatTACCAAACTCAAAGGGCAAAGCCTACTTCCTGCGggttgtcgccctgcgacatatgcaGCTAT
CGGTAACGCTCCTATGAGCTCTGTTGTTTTTTACACGGGTAAGTATACGAGCGCAGTAGCTcaaggccatagcttgagctcagttcATGGCCCTCCGGTC
TCCCGGGCAaccgccgagaagcgcagGGCGCATGACGACACGTAGCGtcatgatcataagcgtccaagacgtctgggcagtctgcTGAAATGACTCCTCA
CACTCCCacaagttctcggagtttggacATCTTCGCCACTTCATAAAATATTGTGTTcgactgtcgacgacgtctaCCCACACAGCGTTCTAAGTGATAG
AAGATGCCactattctcatcgagaagagtcgaagACGGACGATGGCgaattggtcgatcgccgtccggtgacacGATGCTCTCCAAGCTTTATAGGCAAA
GTACGTCGTCATCAgcactccgccgagcatcttgccgtgGTCGCATACCTCTGCACAGTGGACCTCGAAAGCTTGGAGCATTTTCTGTACTGctccgact
gcctcacgttgagaacAATCGGGCTCTGTCGGAGGacctcctagccgtcgagcagaagaaaacgtcactttgtgcgacaGTGAAGCGCCTTacgccattg
gaaatggaaatTCTTGTAATACGTGCTTAAAATTAGTTGCTGGCTCAGATTCTGGATGGCCGAGACAATTTGGGCGCCGcctcggcgccaacgcttccgt
attcacttgcgccggatcctggTACGGTTTAAGCAAGCCCGCATAAAATTACGGgtccgtgtgcatccttctcagaaggtttagcgtatacgctagtcCT
CGCTTGGTCACGAAATTAAAAGGCCCAATAAATCGTGGACGGGGCTTcgtctcaaagacagcagaggctgcatgtaggaaggtttttagcatttgataaa
actagATCTCCGACCGCAAAGGTTTTAAGATTTCGTTTCtctttccatctgcatattctttctgtatgtattggctttcagccatcgcattgcgaatgtg
tcgtaagacactcaatctgatagacaggaagtctccgacttcgTTACGGAGAgtaggctgacatcagcaataagttcggctatttctcccccaccaagcc
ctcaGTCATGGGACGGCGGCGACAGCGGGACACGAGAGTTAACAAGGCCGTTCacatagaacggcgtatGGCCGgtagagcaaactctacgagtggtaac
atggcgctccagcgctacGGTAtctcagtgcagacgctgcgaagagcgtcttcaacgacgcgattcacttGCTCACTCTGACGattggtctgcggatggt
ccgctgttgacacagtcaacttggtgcccagcactctgaagattgtagaccaaaacttcccagtggaGCGCGGGtctttatcagagacaattgacttcgg
GGGTCTATACTGTCGAAAGATacaatcgacaaacagcgtcgctgtactcacaccgtcgatgattTAATTATTTAAGTAgcggtagagccgccaatatcta
aattttGTAATTAATACGGTAAATATCtatttaatatgcattacgactggcagtcctgccacgtggtagcttcttgttacggtgtagccacacctctGTG
TGATTAacccaacttgtgtaatccacacctatatacgatcacaccatcttgttcgacccgccctttcattcaagagtacgtgtaaccctgttacagttcc
aaccatgcaataccaaggataaggtcataccttgcatacAAGTCTAGGACTAAGCAGCCTTCGACGTTAtcgaagaaacttgacaccaaggtccacaggg
acccgtggcacagtgacacatgtTTTATCGCTATGCGAAAAGTGACGGGGTCATTCAACTGCGCTTcctgcgcctcagcatacagctggcttccttcgat
cgtggtgcctcgagcataattgcctgacgcgctagaatcgataaggatctttcatggcttatcaaagcccttcatggtcgcttttacgaccagaaaACCG
GCTGGCATACACTTTTCgtgctcaagagcacggagctcttcagggCTGGGTCTGcattctacctctttgaggctcaacagaactcatttcttccccagtc
gggcgccccgcgcctactgggtgttgtcgtttccccgcgacaaagcAGCCATgctagaagcgggacgtcggtttggtgaacctttacgcgccttgcgcag
gcgACAACCAgtctgaaggtgacgggtgtctccacagacaaaacgccGTCGGGtatttaaacgctgctcggcagctcggagctctttcTCCTCCTTCTCA
ACATACCTGAGattcattggctcaggcccgctcgacgagcgcTGAggatgtgcattccaaccaagtcgtgccgaattgaagttgaattcggcattcaatg
ctacGTTCACCGcatcttcaaaaaaagacggatgcacacgaaagactgtcattctggccacgccagtgcggaggccctccataaaaatGGTCATTGTGAT
CGCCTCGGGGGCAACTAccctggcaatgagagtttgcaactcttggacaaagtccaccaatcccTTCTTGCCCCgccgggcagcaaggaaacgcgatatg
TCTGCTTAggcagcgagaacactcgtaaaagctgcagcttcagctctttcTAGGAGGACGACGCCGCTTTATCCAGAGAAACGCATATTATTGTCTATTT
TCCGCGtgcggcccccgagcttgaaattgctagcgccacgcgctgttgctcgttcttgaGCATGACGGATGCCAAAGCCATCTCGGtatctctcacccag
agcagaagactCTTTTCATTTTTACCCTCggaggtcttaacgctcactatGCGTCCTGGGTCGAGGGGAGTCTATTGTCTTGgacgatggcgtcatggcc
gcagtcgatgccgacagcttctgctgcaggtgctctagcagagctttatcataatttgaaaacgcctctaggcccgcgctagcgacggggacttgtatca
cggtgccgagggtccctgtggacctcggtgtcaagttcttgGCTTTGATAGTGCGGAACGCTGCActcggatgcaaggtatgaccttatcctaggCATGG
caaggttggaacaccatgcgccgtggattgattggaggtcaaagaccttaggcGCTGCATGCACGTCTCCTACTGGagttttggtgagtcatgaatctac
ctctgctaggaagttGAAGTGCTATTGgggcgggcactggaccggaacGGTCAATGTTctcgatatcggagtatccgagttgtcaaacaccgagaGGTGT
GTTGGTCAaaagtcccgagcgtggctcacgggctgaacgtggagtgacacgtaacccactgagcacagctcaagtattggagcatttgctgcatgccaag
agtggcatggtcggccaagggccgagataTTAAGGGCGAGACTCTTgtaatgcacgtgaagtggcacgataACCACTGAATAATGCTCacattacgaagc
agttgctgcgtgccaCGAGAGGCATTGTCGAacgaggtccaaggcatcgagtgcgaggccccagtgatgcgcgtgaagtggcacgtaatccactgaacaC
TGCTTACGTTTGGAAGCAGATGCTGCATGCCGAGAGTGGAATGGTTGGgtacatcttgggcaaggcccttcagatgcgcgacGAGTGGctcgttatccac
tggacaaagactgcggaaataacagctcttcgtcgtatGTTGTTaaaaacatcaaggctccgatggagcagggagtggggacactggacgacgcctaGTG
CGTTTTCCCACTGaactcgatgagacgtaaaacttcTACAGAGAGgggacggcgaagccgtacgatatctgcaagatgcaGGACattgaccctgacccag
cGTGTCTATACTGTTGACGATAGCGTatagctatacacccttgttagTGATGtgacgggagagaaagatggcgacgtcaccttcgaggctatttccgcgg
tgaatgctcttgagcttgacgacatgttcttcgaagagttttgcGGTGCTTTAAAGGTGGGTATTTATCCATGGTGGTCAttttacgaccgaacgaggag
actaactcgtcgtcgcttctggatgaagtagTCCTAGAGGACGCTAAGAGGGTActaaacgcacgaagtggatcgtcgatcccgaAGGATTTCTCGGaac
cgtactatcctttggtatagGAATTTCAAGTCATCGTCTTGAAAGACCCTCCCGATCTTACCTCTGGGTCGAGGTGTGCGTGAttagattgacctggttc
cgggaaccaaatcaatggcccctgcccaaagagcagtgtggcgtcattgacgcctttgtctatgcgaagcacgaggcagtATTGGTGTGTGAGAGAAAGT
CTCCtgattcgacacccacgttttgtgtcaggAAGCCAGACGggaagtggcgtatcgttcactcTTATTAAAGGCTAAACGCTGCTACCGTTCCGGCACA
AAAGCTGATAGCTAAAAAGAATGTTCTTTGAAACAAAATGGGTAGGCggcacaaagtacagcgcactcgacttggtcgatgattgttaccaattgctcat
gagagcgagtgatagtCCGCTGATAGCGGTGTACTGATCTGGTTTtggttggtgatgccccaagggcggtcaaatgcaccagcaacatttggtcGTCTTG
TAACGCAATTTTTcgggccccatcgggcgtatgcacagacatactttgacgacatcttcatcacagtcgtgcgggacacgggaggacagatgagaaaaac
TCATCGTCCATTCAAGAGCGGAGCTCGAGtttatgcgcacgaataagatGCATGCCAATCCCGATAAGTGCCCGTATTGCGGAAACAGTAGCACCtcctt
ttgagctcgaagtcgagcgcggtaccgatccattacAATCGCTtggggtaccaaaaagcgagctcgcaaagttttccgctgatcaagctcagattTTGTA
ATGGCCGAAGGTCCGACCACTTAGATACCtaatgatcgagtgatcgcggctttcgcttcagtagcgggatccgttaaaattgtaaataatcccaattcac
atttaacggtcgcctcatacgagtctgagacaccttgaCGTTTTTCAAGAACAACTTTGAACCTTCTTCCCCGCTGCAGTGTGATTTACCCTTTCAtact
agggtacgtgtaaccccgttacaaactgACGATCGCTGTGTTGTCTGAGCTCGTAGACAAACTAATAGGTCTCGCTGATTAGACTTTTGACTTGAGATGT
AATCGACCTCGTTGTTGCCCTGTAGTAAAGTGTCGTAGCACTGTTTGTTAGGAACCGGTCATGGTGTGCACAGCTCACGCAAATTAATGGGAGCGCTCCA
GAAAACCTCTGCTCTAATGATTCGCTTTATTGAGAGAGGCGATGCCGTGTATTTTTGAGGAAGGCAAGGATTACCGGCAAGTCACAAAGACTTTTTTCAT
CAGAGAATATCTCGCCTTCTTTACCGAATAAGGTTTTTTTGGCATCAACCACAGTAACCACCTTCTTTTCTTTGCCGCTCGCCAAACCATGCGCTTTTGG
CAACAGTTCAGGGAATAAGTAGCCTATATTTGGTGAGGCTTGTGACGAGACAAACGGTTTGTGACCCAACGATTGTTGGGAAGGGTGAAACAGAGTGAGC
ACCTACTATGATTGCATCCATTTTTTCTTCGGACTTCGCGCAAAATCAATAGTATTGTGGTAGTCAATTGCTATGGTGAAGAAGAGATTGAAATGATGGT
ATCTCAGACGAAGTGGTCTGTGGAGTACGTGGTATGCTAGCCTCAAGCATAGCGTTAATAAATTATCCCCCATAGCTAAATGTATCAATTGCAGCTATTC
ATTTTTCTGAATCCATCACTAGACAATCGTAAAGTACTCGAATCAGAGCTGAAGGGGCAGCGTATGGTGTCAACCCTCGTGTGGTTGTTGAAGCTGGCGT
TACAAGTTAAAGCTTCGCAAAGGGCAATTCGTGACGATACTAGCACGTTTTTTAAGCACTGTAAAAGTAATTGTCGATTTATCAAACCAAATCATTCTAC
GTACACAAAAAGAGAGTCATAGAATCATTGACAGTTCATGACGCGGCTATGATCTGAATATTCAGATTGCGTTCTGTTTATAACTATTTGCTTGGTAAGG
GTGAAGGATTAAAGTCCTGGCTGCTATAGACTTCTTTGCTGATCTAAGACTATTCTCTCAGCATTAAAAATGACAGCCATCAAGTTAAAATTCGTCGAAA
TAGCTCCTTCATCGTCGTTCCCCTTGAATGTGTTGTTTAAATCTCGTATTGAAACCTTGTTACAACAACCAATTGTCTCTATGACGTTCTGGTTGGACTG
CATTCCATGATTCTAGATATGAATACTTTTGGCGATAGTACCGAGGAACCAGCTGAGTTGTTCTCAAACGAAGGAGCTAATTGAGACGATGAATTGCGCG
AAGCATTCGGTTTTGTAATTGTCTAAGCTAAAGACTGGCATTAAAAATGGTCAGAGCCAGTTTAACGGGCAGCATACGCGACAAGTCTACCTTGATGTAT
GGAAGTGGACCGTACCGATCCATACTACATGTTTAATATTCTCGTGGTGATATTTCTCACGGCGCGATTAATAGTGTCATCGTTACCATGTACAAGTTTG
GCGTGGGAAGTAGCTGCTTGTAGGAAACCGAGTTTAGTAGATAGATAGTCTGGTTGTCGGTATCGGATTTGCGTGTTTAGTGTAACCAAGTAAGGACCAG
TCGAAAGGGAATTGCTGGGAATCTATTAGGAGTCGCCAAGCATCGCTTAATCATACCGTGCATGTGTACAGACGACACAGCACGTTAGAGAGAACTAGGA
GACGTAGAGATGCATATGAAGGATAAGCAACTAAATCGTGTAAACCTTGTCGAGAAATTAACTTGAAAACTTAGTCGATGCTAGACGTTCAAGACAAAGG
TATATGTCTGTCCAATCTAAATAAAACAACAGCCGAATGCTAGTAAGAACCCCGTATGAATCCTTCTCCCGTGTCATCTGTAACCTACGTGTAGTCAGTA
GAGATAATAGCGATATTGGTGAACAGCATCTCCCAACACGTTCACTAAGTAGCTACGTCTTCATGCTACCACTTGTCGCAGCATCGAAATACAAAGTCTT
CTTGACATGGCAATATCTGAGCTCTCCATCATCATGCGATAAATGTGTTCTTCGCTACAGCCAGCCTTCGTCAACATCGTAATACGCTCCAAAGGTTTAA
GCCAGCGCACTCTTCGAGCGCGTTGCACACGACGCTTGCGCTTTTCATAACAATCCGAAGTATTCACGCTTTCCTTCTGCTCGTGATCATCGTCATTTGC
CGNNNNNNNNNNTAAGATAGGAATATTATCACAATCAAAATGGATCCAGATTTTTCGCTAGCATTCGAAAAATGCGAAAGCTCTATTCCAGAATCACAAT
CTAGCACTTTGGTCGCTTTGTAATGACCTAAGTCCCCCTGAACATGACAAACGTCAAATGGGGCCACCGAAATAAACTTAAGCCTCCTTTATGGCGATAA
TGACGAAATAATGAAATCAGGATACAGTAACGCGTACGATGGAGTTTCGCTTTTCCTTTGTACCGATCAGTAATTGTAGAATCTACGACAAAACAGCCAT
ATGCTATTTTGTCGGGAAATTTTGAAGGTCTCGTTTGTACGCATTCAACTTCAGTGGATATTATTTCATAAAATTGGTTCAAGTGCAAATTACGCTTTCG
AAAGCATTGGATTTTCATGCCTTAGGCGTGACCAAAGCAACTAACACACACGCAGCAAATTTTACCAGAACGGGAGCATAAATTGTGAGTAGTCATGTAT
TGAAACCAGCTAATATATTATCGCACAAACTACTAAAAACTAATTACACATGATCATGCGTCAGGCAGTCAAGTACCTGGATACTTACACTCAGAATTTG
GATTAACTGCTTTATAGAGCCATCAGAATTTACCCATCAAGATATTTCGTGAAGTTGCACAGAAATCACTTCCTTGAACGTATCTATGAGGTCATAGTAG
CACTCAGCTATTCTAAAAAGTTTTTAATTCCGCTGAGTGTCGATAGGCTAAATATCATTATACAATTGCAAGTGCACCCCCTCCGCGCTATTACACTTTC
GACGTCTAAACGTNNNNNNNNNNtcgtgtaaccccgctaCATACTCACAAGACCATAGGTTTCGCTGCTGATATACGAGATTGACGTCTGTGCGTTCATT
AACATGGActattgagtcaaagctttctctgagCAACGTGCACGGTAACCTCGTTGCACTTGTATCATCCCCATGACCGAGTTATAAAAGGACTGTGTCT
TCATTAAGGAATAAATTAGACTTGCTTGCGTACCTGTCCCTGGGCAAGGAACCAGCTTAGTAAGCGTTATTTATCGTTGGCCCCAGTCGGATCAGAGTAC
TGGCGACCAAAGGGCAGTTGAGGATCTCGCACGCGCGGAAGCATTGATTATCTAAAAGCATACAAATCTGAGGCGAGCGCAGATGAGAAAAACACAAGCC
ACCCAGCGTGAGGCTGCTGGTTTTTGAGCGTCGACGATTATCTTTTTG