Description :
From Genome Similarity Track
Location :
Scaffold_36:118233- 119630
Transcript NameFunction/comments
Hyaar_Emoy2805199Major Facilitator Superfamily (MFS)

Sequence
1397 bases(100 bases per row)
AGTATTTTGTTCCAACAGGTTGTTGCTGGCTACGTGTTTGTGCTGACCAAGTCAACAAAAGCCGTTGGAAACGTCAAAGGCACTCAAGGCATTTCCCAGC
TCGTGTTCTCCTTCCCAGGCGGGTATTTGGCCGACCACAGCCGTCGGGATGCCGTGCTCAAGTTCTCGGGTGTTATCGGAATTGTCAGTTCCATCGCCAC
TTTTATCGCCATTGAATGCACGTCCATCAATGGTCTGTACGTGGCCTTTGGACTCTGGGGACTCTTTGGGGCGTTCCAAAGTCCTGCGTTGGAAGCGCTT
TTCGCCGACTCGATTCCTCCTGGGAGACGGAGCTTCCCCTTTATGATCAAATATAACATTAGCAACTTGGCGCAGATGCTGGGACCGATGCTGAGCATTT
TCCTCTTCTGGATCTACGGGGACAAGTGGCAGCTGCCAGAGCTCAAGACTGTGCTCGAGCTTGGAGGCGTCTTGGCTGCTGTTGCCTCGTTCATCTTGTT
TCGCTTCGATGATGACCGAGCGAGGGATTATATGCAGACGGAGACTCAAGAAGAGACGGACAGACAGATGAAATTGACCCCTCCATCGCCTATTCGGACG
CCGAAGCTTGTTGGCAATGAGATGGACTTGGTCTATGACTACCCTGATGAAGACGACATTGTGATCGAGAACCATTCGACGCCAACAGTCTCCGAGAATA
CGGCACTGCTGCTATTTAAGGGAAAAAGTGCTGAGGAGATGGAAGAAGAGCGTCAACAACGCTTACAGCCAGTAATGGACGATGACGATGAGGGCTACAT
GGGGAATTCTGATTCCAGGTTCCTTTGCTTCCGCACGAAACATGTGCCGTATATCTTGTTCGCGTCGGACTTTATCATTTGCAACGGAGCCGGTATGACG
ATCAACTTCTTCCCGTTGTTTTTCAAGGAAGAGTACGGGCTCACGCCCGTTCACGTGTGCGCGCTCTTCATGACTCAGCCACTGATTGTCATGATCCTGT
CGTTCATCTCACAACGGCTGTCCAAATCGTGCGGTCGTATGCCAATTATTGCGTTCACAAGGACGTTCTCGGTAGCGTGTCTGTTTGCGATGGCCTACGC
ACAACCGGTGGCTCTACAAATTGCACTTTTTCTGATGCGTGGCGGGATGATGCGGTGCTCTCAACCTCTACGTCGGTCGATTCTGATGGACTACGTGCAG
AAGAACATTCGTGCTCGCTGGAATGCGCTGGAGGGCTTGTCGGTGTTTTCCTTTTCGGGCAGTGCTGTGCTCGGAGGCTACCTCATCGATGCGTACGGTT
ACCGCATCTGTTTCATCATCACATCGTTCGTCTACTGCGTCGGTCTGAGCTTGGAGATGTTCTTGCTGCCGCTGACAAAACATGCTATCGAGAGATA