Description :
From Genome Similarity Track
Location :
Scaffold_262:11819- 13012
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_262-snap-gene-0.17Regulator of chromosome condensation (RCC1)

Sequence
1193 bases(100 bases per row)
GTTCCCCGTCTTGATCAGTTTTTTCTTCTTCCTTTCCACCAGTGAGCACAACCGTGTGATAAAAACCTGCCGCGACCATCGCGATGCGTTTACCGAGAAA
ATCTTCGATCGGGAATGGGTAAAGTCGCTCGTTTGTATCGCCCGTACCAAGTTGTCCGTGATTATTGCGACCAAACACAAATAACACGCCGTTGTCGGAC
ACTGCGATCGTATGGTAGCAGCCACACGCGAATCGAATGATTTCCTTGCCTTCGAGCTCTTCTATCAGCTGCGGAGACGCAAAGCGTTGCTGCTGGAGCT
GGAGGTTTGCAGCTGCAGTCGCATTCGCCTTGCCCAGTCCCAGCTGCCCGTAGTCATTTCGCCCAAAGCCATAGAGATGAACACCACTGCAGAGGACGAT
GGTGTGGTAATAACCGCAGCGGATTTCGAGGCACACTTGCTTTTCAAGACCGTTGCGCACTTGGACAGGCACCAGCTGGTTCTCAGCAGACTCCGTTCCG
AGTTGACCATAGTCATTCTTGCCAAAACCGTACGCTTTCCCTGTTGAACTTACGACCATGGTGTGATACTGACCGCACGCAACCGAAACGATTTGCTGCT
CTGCCAACGCATCGATGTGATGCGGCACTTTGCGGTCAATCGTATCGTTATGGCCAAGCTGACCATAGTCGTTTCGCCCGAACGTGTACACAAACTGACG
TCCCGCGCCAGCGTCCTCGCAAGTGAGAATCGTGTGGTAGTAGCTGCACGACACAAGCCGGACGATTTTGCCTTCAAGGCTACGGATCAGCTTGGGTACA
TTTTCACTGGTCGTGTTCCCGTGACCGAGTTGACCTCGATAATTGTAGCCGAAAGTAGCTGCTTTCCCGTCTTGAGTCACGATCACGCTATGCTCACATC
CATTGTACGCATGCACTTGAGAGATTGCATGATCGCCAAATTTGTGAATTTCTGTCACGTTGCTCACTCGATTGGTCACGCCGACACCACACTGCCCATT
GTCATTGTACCCGCACGTCAACACTGTGCCATCGCCACACAATACAATGCTATGCTCGTTTCCAGCGCTGACTTGAACAACGTCTTTGCGCTGCAAGGCT
TCAATTCGATCAAAAGACTTGCGAGTGATTGTGTCTCCATGCCCGAGTTCACCGTACGAATTTTGGCCACAACTCCACACTTCTTTGTCTTCG