Description :
From Genome Similarity Track
Location :
Scaffold_947:11819- 12925
Transcript NameFunction/comments
Phyag_g8825hypothetical protein PHYSODRAFT_555658

Sequence
1106 bases(100 bases per row)
GATGATCTACTACGACTCGGCTCGGTTGTGGGGGATTTTGCTGCGTTGGCACGGGTCTGCATTGAGTGGTCAAGCTCCGGTGCGAGCGCTGCAtatggcg
gtggtggctctGATCGTCTCACTAGCGGNATCACTATCACCCGTTCGTGGTGGCGACCCGAAACTCGACGGCGTTCACGGATTCCTTGACAGTGTTCAAC
ACTTTTCTGGGTCTTGTCATCTCGTTCCGGTTGAACTCGGCGTTCAGCCAATGGAGAGCCGGTATGGTGGCCATGGGGGCCTTGTCGGAGGCTGCTCGAG
ATATCGTGGGGTCAGGGTGTGCGTACGtgagcaccaccatcaaGGAAGAAGCGAAGGAACGCGCCGTCGATGAAAGTGAAGAAATGAAGCAAGCTGAGGA
TCTGggcaagcagagcaaacagcttgacggcgacgacaaacCGCAGCCCATTTCACGGGACATCCTGGAGAAGTgcaccttcttcacggaATTACGCCGT
CTTGTGTTCCTGTACATTGCTATTGTGTTCCACGACTGCCGTGGTCGTGATGGCATTGACAAGCTAAAAGACGCGGGGGTGCTCACTAATGCAGAGTACG
ACGAGTTGTATGCCAGTGGATCGgagcacaagaaggaggtcACGGAGATGGAATCGTACGGAGATGTTGTGCGTCGCACCCCTCACAAGTTGCGAGCTAC
GATCACGGAACTTTGGCTCAAGCGACTGGTCCAGGTTGCGTGTCAGGTTGGACATTTGACGCCTGGTAACGCTAGCACATTGCAAGGGAAGATTGCGCAA
TTGCCGAACTTGTACACGACGGTGTTCCACATTGCCAACATCCCGATCCCGTTCAACTACATGCAGTACCTGCAGTTCCTGTTGGCAGCCTACATGCTTC
TGTACATGTTCGTGATCGTGCCCAACTCGGGACTTTATACGCCGATTTGGGTGTTTCTGTGGGGCACGTTCCTGTTCATGGCGGATGAAATCGCTCTGGA
GATTGAGTGTCCGTTTGGGTTGGATGCCAATGACATTGACTTGGAGGAGAGACTGTTGCAGATTGAAGAGGAACTCACAGTGTTGGTTCGCAGTCAGTAT
TATTTC