Description :
From Genome Similarity Track
Location :
Scaffold_29:1181605- 1189572
Transcript NameFunction/comments
Phyin_T30-4PITG_13586Pterin-4-alpha-carbinolamine dehydratase

Sequence
7967 bases(100 bases per row)
TGGACGACGCTATTTAGATATGTTCCACCTATCAGATAGCGCGAAAGGGGGCTTGTGACGCCGATTTAGATTTCGTAGAGCTTCTACAGGCTGGCATACA
ACTATCTAGAATTTGCACTGCGACAAAACTTTCGGACAAAAAATGACATGATTTCATTATTGAAACTATGCCCCCCCCAAAACTGGCCTTATTATCCTAT
TTCTATAATGGGACAAGGACTAAGCATCACTGATGAAGAACGTGGCCGCATGAAGGGCCTCCACGAGGCAGGCTTGAATGTCCGCCCGATCGCTCAACGG
CTTGAGCGGTCGGTGAATGGCGTCAGCTACGCCCTGAGGGCACCTACCACTAAAGCCAAGAAAGGGAGGCGTCTGGCAAGCCTGACAGACCGCCAAGTCC
GCCAGGGCGTCCGCAGTGCCGCAGCAGGAGACTATCGGCGTCCGGGTTGAAGGTCACGTACCGCTTGGCATGCTCGGTGCGTACGATCCAGAGACTTCTG
TCTCGGGTAGACTATCTAGTCTACTCTAAAATGGATCATACGCTACCTCTAACAAAGGAGCACAAGGAGGCGCGCCTAGAGTTTGCCGAGAGGCTCTCGA
CGGCTGCGCAGAAGGAAGAGGTTTGGCCCATGATCATCTTCTCAGATGAAAAAAGTTTAATCTCGACGGCCCATATGCACTATTGGCGTGACGTGCGACG
TCCTTCCCGTCGTTCCATGTCTCGCCAAAATGGGGGAGGCTCACTAATGGTCTGGGAGCATTCGGGGTTAAAGACAAGTCGGAGTTGGTGGTTCTGGATG
GGCGCCAGAACTCTGGCCACTACATCTATACGATGTCGGAGAATAGGCTCCCATTTGCCCACAAGAACTACGGCACGGATTTTGTATTTATGCAGGACAA
CGCTTCTATCCATGCCTCGTACGCAACGACCGAGGTTTTCACGGAAACTGGGGTGCCGCTGCTTGACTGGCCAGCTCGCTCACCCGATCTCAATCCGACT
GAGAACGTGTGGGCAATTTTGGCTAGGAAGGTCTATAGTCATGGAAAGCAGTACAGCTCTGTAGCTAAACTCACTGCTGCTGTCATGGAGGCGTGGGATT
CAGTGACGATGAAAGCGCTGCTGGAACTGGTGGCCTCCATGCCTTTTCGTTGCTTTGAGGTAACCCGCACGAATGGCGACAAGACACACTACCAGCTACA
TTATAATCATGTCATTTTTTGTCCGAAAGTTTTGTCGCAGTGCAAATTCTAGATAGTTGTATGCCAGCCTATAGAAGTTCTACGAAATCTAGATCGGCGT
CCCAAGCCCCCTTTCGCGCTATCTGATAGGTGATACATATCTAAATAGCGTCGTCTAACTCGACCCAGAAGCCGAGATACAGCCAAAGGTATAGGTGTCA
CAGAACTTATGTTGCGGAGTGTTTTTTGTTTTATTAAACTCGAATTTTTTTATTTTAGCCAGATAAAATCCGAAGCAATTACAAAATGCCGTAATATGTC
TTACAAAATGTTCTTACTTTAGGTACACTTATTCAAATTGGAACTAAAATAATAATAAAACACCAAATATTAATAACAGAGCAAATGCGAAATCGTTACC
AGTCGCGCTTCGCATGGCCGGGCACCCCAAGCTCCGTGGCTCGCTTTGATCGTGATATAAAGATTGAATGTACTAGATAGTGTAATGCGCGGATCGATGG
AGAGCTTGGCGCTGGGCCCAACTTCGCAAATACCGCACGGCCCTGCTTCGCGGGCACCCCGCACGGATTGCTGCGTCTACGCGCGCTTACTACGTAGCAC
TTGGGGTGGTAAAGCTCCCTCGCTTTCGGCAAGCGATGAAAGTGTTGCCAGTGGTCTCGTTAGGCGATACTACTACTACTATTGCTACTACTACTACAGA
GTCTGCGGCTTCTATTATGACTGCTATTGCTGCGGAGACTGTGTCTCCCGCTACGGCTGTTATTGCAACAGGGTGAACGGACTAGACACAGACTGAACTC
TGTGAGACTGCGAAGGACTAGGCCGAATGCCAAAATGCTCCTTTAGTAACGTCATTATGAGTAGCTTGGCCCTTCTGGATGAGACTCGGCAAGTCGTACT
GCTACTCGGGCGTTTCTCCGACGAGTACCGTATGCTGACTTCTGTGGCTACACAATTCCGCACCCGTCAGAGCCCAAGATGCACATCCGTCTTCAGACTC
GTCAAGGTATAGCTGCAGTCTGCAGCTCTCGCCATTTGAGTGGTGCAATGACTCACTGCTGTTGTTGCTGTTGTATTGCAGGCGCACTTGCCGATGAAGC
GCTGCGCTCCGGTCTCACGGACTTGCGCAAGGTGTCGACGCAGATCGGCGACGCCTACCGCAAGGAACTTAAGGCTTTTAAGCGCAAGAACCGCAAGAAT
TAGACTCTCATGACAGAATGGAAACACTGTCTTCACTCTGTAATCATTGACACGTATCCTCTTGCATGTCTTCACCTCAGTACATGTATTCGCAACCTTA
TCTTCCGGCAATTAAGCAAGTTTTACACTAACGTTACACCAAGTTTGGACGCCGCCAAACGACGCGTCCAAACACTAATTTCATTGGTCAAAACTCGTCA
TTCCGGTGTCAATATCCGCCATTATTGAAAACACCGTTTGACAAGCATGACTCTCCACATGCTCCGTAAGCTCCCCACAAAGCCGCTGCTTCACCGTGGA
ATGTCTACACGCGCCATTCCGACGCTTCTGACGGAGGAACAACGTACCGCTGCTTTCCAGCAGATCACCAGCGCCTGGGAAGAGGTGCCTCACCGTGACG
CCATTCGCCGCAAATTCGAGTTCCGTGACTTCAACGAGGCCTGGGGCTTCATGAACCGAACAGCGCTGCTAGCCGAGCAAATGGGCCACCACCCGGAGTG
GTTTAACGTGTACAACCGTGTGGACGTGACGCTCAGCACCCACGACTGCGGCGGTTTGTCCCAGAACGATATTGACATGGCCATCGCCATGAACAGCTAC
GCCCAGGCGCTGTGATTCTCTTAATATCTCAATGAAAAAAGCTAGCGACATGAAGAGTTTTAGTACGTTATCTAAACGCTCGGTCTTACTAGTGCAGGGG
CAGGACTTATGGCCATGTTCTCGTCATCGAGGTCGATATAATAGTATGTGCCTAGCCAAGTGGGATCACAGGAGACAGCGTAATCGACTGGAAATTCATT
GGCTCCGGATGATCCATGAGAATGGGTGCATAGTCAGAGGATGAAGAGCTGTACGCATCTGCCACGCCACTTCGGATTTTCTCGAGATCAACGCAGTACG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTTCTTCGTACTTTTTGGCATGTTGCGGGCTCTGTTCAGTAAAACCCTGACTATAATTCGGTCTGTAAAGTGGTAAAAACAATACATAAATC
CATGTATTTATCGTGGTACCGTCCAGCAAAACATTGTGAGAGTCTCATCACCACGCTAACATTCTTTTCAGGGCTTGGTTTCCTACCCAGATATTCGCGG
AGCCATCGAGGCTACTATGCCTTTAAGTAATATTGCATTTAGCCAGTATACAGATAACTCAATAAATCGCAGCATATATCAAATTAGAAAGGCGCTCATA
TCAGAAGGTGTTAATGCTAAAATCGGAAGGTATTATTGCTTCCCTCTTCGTCACGCCAAAGATCTGTCATGAACGTTACCAGGTCATGTGCAAAAGGCAT
TATGCACTTAGCACCCTGTCCCTTAGACGTATTACTTGTCTGTGGCCCGTCGAACTCTTCAATATTCTCCTTGACGTCGATCCAGTCTCTTAGAGTGCGA
CGAAATACGTCGAGGCTCTCTGATGCAGGTTTACACCCTATCAAATCAGCACGGATGATGACTTCACGCTTTTTGCGGATTAAGTATGAACGCTGGGGCG
CTATTTTGAAAATGACCGCTGTATAAAGGAGCCCACACAGGACAAAAACTCTCAAACCTGCGAGGTCAAATATCCAGAGAGCTTAAACTATTTACCTACT
TACGCAATTGGAACTGGGCCCATTACGATTTAGCGACATGGTAACATTAGCCACTGGCCGTCGGACGAGTTGGATAGCAGATGCATGGAGAATTGATCAG
CGCCAAATATATGCACGCACGCGCGCTCCCGCATCGATGAAGTGTATCTGGCCGGCTTTAAAGTACTGAATAAAATCAAATAATTGGTCCAAATTGAATG
TGAGTTCGTGTTATGAGTCAGAACTTCTGAATGACATCACCTACAGTAGCTGCAAAGCACCTCGAATATATAATTACTGTACCCAATCGATATCGATATG
TTTTCAGAGCAGGTCCAGGCTAGTTTTGTTTAATCGGATATTAAACTGACTGAATACTTAATAAATTAAAATACCTTAATTAACATTGGGTGAATGTTGG
CCCAACTGGTGAAGAACGGCATTCGCGCAACATAACAATGGGCTAACACTAAAATAACTATAATACACTAACGCAGACATTGAAACAGCGATCGCCGCTA
TCGAGGACTAACAACGATATAGTAGTCCTCAGTATCTCTATACACGGCTTCTCCGCACTAAGGGCTGCCGACTTCAACAACAAGCCGTACAGATCCAAGA
CTGGCAGCTGATTGATGCAGTCCGTGAACGTGCTCATAAGTACGCTTGGGTCAGATGTCAGTGTGTCTAGTAGCTACCGATCCCTGTCGGTATGTAAAGC
TTAAGCTATGGACGTTAGGGGGACTCTTCGGCCTAATGGGCATGGCTTTGGTGAACTGCTTCATTGTGTTTCGCCCAGGAAGATGAAGAACAAGAGCCCG
GCCACACACTTTCCGTTCTTCGAGACACCTATGGAGCAGCTCCTGGTGATTGACTTGCCCGAGACGTACGACGCAATTGATGTAAGCGTAATGCTGACTC
AGTCAACATAGCCCAATGCTACAAGTTTTTATAGTCAACGTTACATCATCTGATGCTGCAAACTATTTTACAGAACGCAACGCGTGTTCAGGACCGAGCT
CAGCTTCTCCGGTGCGCGCCAACAGAGATGTAAGCCTGCGCGTCCTACGCAAGCAGCTGACGAGTGCGGTCATCACTGTGGTGAAGTGCTTTCTCAGAAA
TAAGAGAATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGATTGGCACGGGTGCAAGTTGCCTG
TGGTGGATTAGCCATGACGAGCGGCACCCCGTATGCTATGACGATGAATCTGGTATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGA
TCCACCCTTACCTGGATTCACTTAGATGGATATGGGATATACTATATCAGAGTGGATTGAGTGTGGATCCTATGAACGAATGATGGTAGGTGCCCTCTGA
AGGTGGATCTAGTAGCCACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN