Description :
From Genome Similarity Track
Location :
Scaffold_791:11814- 12920
Transcript NameFunction/comments
Phyta_totarag10735hypothetical protein PHYSODRAFT_504737

Sequence
1106 bases(100 bases per row)
CATTCGCCGAAACGGACTCTTTAGATCAATATGGCGACGTGGATGAAGTCGCCGCCTCTGGACCCTCGCGTGCTGGCAAATGTAGTGCGATTGTATGAGG
gggagacgctgcaggtggcggaGTGTGATGTGCCAGTTTACCACGGCAAGGGGAGACTGGAATTCAAGACGGGGTTCACGTACGTTGGGGACTTTGCTCA
TGGACGCATGCATGGTACAGGCCGCATCGAGTGGCAGGACAGTGGCGTAGTATATGAGGGAGAGTTTACTCACAACGAGATCACTGGACGAGGGACGTAT
TGGTGGCCCAACGGCAGCTCGTACGTCGGAGATGTCAAGTGCGGCAAGCGACACGGTCGTGGCGTCTTCGTTACTGGAGACCGTGGGGTtgtactgcagc
aatcgAGTCACGAAGAGGGTCAAGAGAAGGAAGGCGATGAGGTCCCCAAGCCTCTACTATTCGCCTACCGCTCCCTGGACCACGAGGGTGAAAGTCGCGG
TGGAAATGACGAGGACAAGGGTGAAGAAGGACCGGATGCTGCTGGCTTTGTGGTGGCTCAGAGCAACGCTCGTTATGACGGTGAATGGGAGAGTGGGCTG
CCTCATGGCTACGGGGAATTGGTGTTCGACGCTGCGCGCAACATTCGCTACGAAGGGCAGTTTGTAGAGGGAAAACGCGAGGGCAGAGGACACATGCACT
ATGCTGATGGCAGCGTGTACGCAGGAAACTGGAAAGCTGACGTAAAATACGGCCGAGGAGTGATGACATGGATGACTCTACATGGTACAGACGAGGTGGC
GAATCCAGAGGATGCAACCCCACTGGAGAGATACGACGGCGAGTGGAAGAACGACTGCCAGCAGGGTTTTGGACGGCACGTGTGGCTTGTGAATCCTCTT
AACGCATCGACCGCTGGGtcaaccagcagcagaaatgGGCCCTTAGCATCCAGTAACCCACACGACAAGAACTGGTACGAAGGCGAGTTCCACGAAGGGC
TCCGTCATGGACGCGGTGTATTCTTCTACGCCAATGGGGCCCGGTATGAAGGTGAGTGGAAAGGCAACGTCAAAGACGGCCACGGTCTCCTCTTCTACGA
AGACGG