Description :
From Genome Similarity Track
Location :
Scaffold_729:1181- 4640
Sequence
3459 bases(100 bases per row)
CGCTAACGTCTGCCATTCTGTGTACCGCCGTGATCCGACCGATATATATCCCGTCGATCGAGGTATCATGTCGAATACCATCCACAAACCTAACAAAGCT
CAATGACCCAGAATTATATCTCAATCGCTAAGGTTCGTAAGCTGTAAATATCTGATCTGACCGGTTCAAATTAGTCACTGTCGGCACCCACACCACTTGC
CTCACCTAAAGTATAGCCTTAGGTGGACCAACCCCGATGCGTAGTTCCATCGATTTGCCAACCGGAATGACCACAGGTTTATCATTCAGGTTGATCGCCT
GTATAGTTAATAGATAAGGCGGATTTCGTCCTGCCAAACTAATCCGAACCTCGTCTGGTAGACACAATGCTCTGTCAGCTAAATACAGACGAATGCCCGC
CATAACCATAAAATACATACCCAATATGGCTTCTTGGCCGACTTGATCACCGACCCAGACGTCGAAATATTACACCAACGATCCGTCCAATGTAATCTTG
ATCTTTGTCCGCCCCACCGTCATATATACATTCTCTTCAATTCTGACGCACTCTTGTGATTGACTTTCATCGATCCCACATCCTACCGTACGAGCAAAGG
TTGTATCGAGGATCGACACTTCAGCGCCAGAGTCGAACATCATAGTGGATTTCTTATTGTTGATCTTGCCCGCCCCTTTTGCTTGCTTGAACCATTTTCC
AAGAATGTGAACTTCTAATACCCGCGTGATTCCCCAGGTGCGAGGTCTATCTTCATCTTCGCAGGCGATCGGGCATAATTATTCACCTTCTTCACACTTG
ATATTGACGGGACCAATGTAAAATCATTATGTATATTAGCGATCGGATCAATCCGATTGTTAATCTCTTGATCATTTCGCTCTTATTCAACAAATGCATA
AATTCAAAGCAAAATTGCTCGGCTCGTGCCATATTCCAACCTGGCGAGCGTTCTAGTTTAACGTATCCTCCACCTTGGGCGGAAACGATCCAGCGTGCTT
CGTGGGCTCGTACCACTTTCGGATCAAATTGAAAAATTCTTCCATGGAGCATTTGCGACCCTCGTGTATCTCTCCGTAGGCTGCACACACAAAGAAACAT
TTGTTAGAGTGATGTCGTTTGCGACCACATTTCTGGCACGTCAAACGCTTCCAGAACCCTCGATCGTCGTGTCTAGTAGATCCACAGTGGGCAGACGCCC
GCGATCGTCCAAAACGATCGTGATTATCCCCTCGACTAGTGTCCTTCTGCCAGGTGCGGTGATACTTGTCCGGTTTTCCTTGGTCAGGTGTAGTTTTCGC
TTAAACTCGGCAACGATCTACGTCTTCATCAGATCCATTTGACTCCGATTCCGATATACGTTTTTCGACTTTCTCGCGGATCGATTGCACCGCCCGAGTT
GCCTTTGATGACATCGGATTTGAAGACGCAGTCGTCCGCCGATGGAATTTGCTCGATCCCACTGACGCTTTCTTCTGGCGAGTCTCCATCCGCTGGCAGG
AACGTTGGGGTTCCTCCATCTCATCAATATCCATCAATCGCAGTAGGGTCAGCTGCTTTGCCAGATCGCAATTGTCCAGAATAGCAATGAAGTGCCCCAC
ATGTTCGCGACGTGTGGCCTATGTAGCCAATCTTTCTTCTCAAATCGCTATCTTGGCCTGCTTTGGCACAACATTAAGGCGATGCAGGTACTCCAGGGGG
GTTTCATCTGATCGCTTCCGTGCGAGATAATATTGTCTGGCCACAGACACACCTTGCCCTCCATATTGTATCATAAAACGGTCCAGCAATCGCTTACATT
TGTACCATGTAGATCGACTCAGTTGGTTGTACCAGTTTTGTTCTGGCCCTATCGACAGGTCACCATACACCAAACACATTTCTTCATCTGACTCCTGCTC
GCGCAGGAAAGCCGACTTAACTTTGTCATTCCAGCTTCTGGCCCGATCTTTGCCTCTGTCTTTGCCATTGAATTCTTTCAGCTCTGTCATCACTGACACA
CGAATACTTTAGGGGAACTCCGCCACTATTCTGTAACGTTTCTGTGATGGCTACCAACGCACTTCTTCGCTCTTCTTGCCTCGAATTATCGGGACCGACA
TCTTCAGGATCGAAAATGCCCGATCGACTCAGATGCGTTTGGACCGATTCCATCTCGACATATGGGGTGTATGCTTCTTGGGCTTTTGCAATTTTGATCC
TTTCACTAGGGTGAATCGCTTAATACGCTCGTTTCCGTCGTTCTTGTTGAAAACGTTCCATGGACTCCACGAGGTTCGCCTGCAGGTGGCCTTGCGTAGT
CGAAATCATCTCTATATTAGCGCGTGCGGTAGTCGATCGTGGTTCAATCTTTATCGTTTCAACTAGATCACGCAGATGTGCCGCCCTAATTGGGCCTAAA
GACATCCGATGAATGCCGATTGAATCATCAGAGTCGATTTCAGATTCAGCTGAGGCGTACTGCAACGATCTGGTGAGGTATACTCTCGGAACGTCTGCGA
TTGCTATGTCTGTTTGATCGGTAGGGTCGCACTTTCCCATCAGAGGAGTTAACGTGTCATATTGCAATCGATACGCATGGATCACCTGGTCTTTTTCGAA
CTCCAACAAATAGTTCACGTTGAACACCTCGGCGTCATGGAGAACCCGTATGATCCCGTTGACCTCGTCCGGCGCATTAGATGCTACTGCCGGTGGGTGT
ATCGGACCTTGGATCCCTCCGATCAGCTTGGGCTTCAGTTCCGGAGCACTGGCTTTCTTGATAGAGAATTGTTGAGTGTCTTCCAGTGATATCTGCTCGC
CAACTGATCCAGCTGCCAGCCTTCCATCTTCATATTATCTTCCACGAACTTGATCTGTTGATTGATCGATTTCAAGTTGCGATCGTGTTGATCCGATCTG
AGCGCTTCTTTCTTTACTCGTGCTGTCTTTACGTTCTTCGTCTTGACTTTTCTTGAGTGGTTTTGAGTGATAACTGATCGGTTTTATCCGAACGGTTCTC
ATCTAACGGATCGTACTTTACGGCACAATCGGCGGTAGTCCCTAAAAGGACCTCAAGAGGGGGTCGAGTTTTCTCTTCCAGATCGATCAACCGAACTTCC
TCTTTAATTTTTTTGTCATCAGAGCCCCTCCCGAAACTCCGATAATCTGGGGATACTTAAACCACGCGTCTGGGGTGATCTCTATGCCTCTGACGTTTCA
ATCCCAGATTCAGTCTTGATCCTGGCGTCTACCTAAGAAACCCACGGTGAAATTTCGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGTG
GCGATCGCTCATTTTATTGAGGCGACCACAACTTCCCACTGGCGCCCAGACGACCGACTAACGGAGGGGGTACTCCGATTCCGTGTAGATGTATTCCTTC
CCCACCTCGTGTACACGTCCGTAGGGCGGACTGAACTCTTTTTGGTGGACTCGAGGGAA