Description :
From Genome Similarity Track
Location :
Scaffold_1856:1181- 3792
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1856-snap-gene-0.2Bromodomain containing protein
Pytir_DAOMBR486maker-pir_contig_1856-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2611 bases(100 bases per row)
GGGGACTACTATGGATCCAGAGCAGAAGAAGAAATGCAGCGAGCTGCTCGAGTATTTCATCCGCCTCGACAGCAGTGGTGCGTGGGGCTTTGTTAATTTG
TTGACTGGCGCACAGTGTAGATGAGATGGCCTGCTTACTCTTGTTATTGTTGTGTACGCGTCTGTGGATGAATGAATGTTTGCGCGTAGAGCCCTTCCGG
GAGCGCGTGAATTGGGAAGAGTGGGGGCTCTACGACTACCTGCAGATCGTGAAAGTGCCGATGGACCTGGGTACGATTCGCAACAAGCTCAGCAAGAACG
ATTACAAGAAGCCCGCCGAGTTTGCGAAGGATGTGCGTCTCGTCTGGGACAACTGCAAGCTCTACAACCAGGTGCGTCCTGCGGATGTGAACTCTTTACG
TATGGGTTGGGTAGATAAAGAGATACTGACCCCTGACGCTATGTTGTGTCTACATATTAATCTGTGTCTTTAGGACGGATCGGAGCTCTACGATATTGCG
GACGGCCTCTCGAAGCGATTTGAAGACCGCGTGAAGGCCATGAAGCTGGACGTTGGCGCTGTGCCGCGCGCCGACAAGAGTATCCCGTACGTTCTGCTGA
ACCGTTCTAGTTTTTATCAAAGTATTCTGGGAGTGCTAATGCTAATGCTAATGCTGTTGCTGGTGTGAATTGCTCTGTTTTGTCTACTGCAGCGCGCCAT
CGGCGGAGGAGAAGATCTACTTTAGCCAGAACATCTACAAGGTCACAAGCAAGGACCTCGGCGCGATCGTGTCGATCCTGGAAGAGAAATGCCCGAAGGC
GCTGGATAAGGCAAGCCCCTTTGTTTTGTTTTATTGCAGAGCAGCTCATTATAGTGGCGCTTCCAATGTGTGTGTGCTAACACATCACTCCCTTTGCTGT
CCTATATTTTGCAGAGCTCGCCAGATGAGCTGGACATTGTGGTCGACTCGATCGACGCCAAAACGTTCCGCGAGCTGGAGAAGTTCGTGGTCGAGCGCGT
ACCCGAGGGGAGTCGCGAGCCTGTGTCGACTCCAAAGTCGTCGTCGCGCAAGTCGTCGTCCTCTTCGTCGTCGAAGCGCTCATCGTCCAAGAAGAGCAAG
ACGAGCGAGTGAAGAGAGCGTCAGGTTATTTAACGGGCAACGAAGAACAAAGGATAAACAGCGCAGCGGCACACAAGATACACACAAAACGGTGGTGTGT
GTGAAGAGGTACGTGAAGTAGGTGGTAGTCGGGGAGGAACAACGGTGCGTGGCGAATTGCCTTTTTTTTACATTTTCGTCTTCCTCTATTCTTTCGAAAC
CACGATCGGTCCAATCGTCACACATGCGTCACTCTCTCTGCGCGAGAGTGGCACATGTGTGTGTGGCTGGATAGAGCCTTCTTTTTATCGTAATGCGTTT
GACTTGCTTGTTTGTTTAGTGTGTGAGAGTGGATGATTTCGGCGCTTGCGTCTCATCTCTTCTTCAGCATGGTAGCGAACTTCGCCTGGCGCTGGAACGT
CATCTCGAAGCTCTTCCTCGGCGTGTCGTTGTCGTTGTCATCGTCCTCGCCTTTCTTCTGCTTGAGAGCTAACGAAATGCTGGGGGTGGTGGAATTCGCG
GGGGTTCCACCGCTCGAGAGTTTAGAGAAATCCAGTGGCGGTACGGACAAAGTTGGCTTGAAGAGATCAGCTCCACTTGTAGTAGGCTCTGTGCCTCTTA
GTCCATTGCTATTGTCTCGACCAACTGAAGGAACTCCCTGTCGAGTGCTCGCGACAGAGCCAGCCACGCGACGTGTGGACTGCCATTGCGGCGACACGAC
CTTGGCTGAGATCAGTCGAGTAGTTGGCTGTTGTGAGCTCTCACTCAACTGTCCATCTGGGGCTGAACTGCGATCTCGTGTAGCAGTACTGACGATCGGA
ATACTCTTTGGATCATTTCATCCATCCATCCGCAAACCCGAGTTATCAAGTGAATCTTCAATTGCGGAAGTGGTGATGAAAGACAGAGCCACGCGAGTAC
CTGGGAGACCGGGAGCTGTATGATGCGCGAGCCACGCGAAGTCGCGTTCCCACCTTCACGCTCCAAGTGTTTATTCTCGTTGATACTGTCTTTGAGCTCC
AGCAGCTCGTCTTTGTGCAGCTCCATGAGCTCTCTGAACGCAGTCGAATGTTGTCAGGAGGAGAACCAGTTGTACGTGAGCTACCCAAGCAATCCTATGA
AAGAGCCAAGACAAAGTCGAATCCAGTTGATCGACGTACACACACACACCTGAGCGATGGCTGGTCACCGTTGGACGCGTTCCAGTTCTTGCCGTGCAGC
TTCTTGCCCGCCTTCATGATCTTGCGCCACTCCTGAACAGCATCCGTCCGCCCAGCCAGTCAACCAATCAGTTCCCAGACTAGGTGAATACGTTGGATGC
CAAGGTAGTGATGCACTAGCTACCAACTGTACAGCTACAGCACCTTATCCTGCTGATGACTTGTCTCGACTCGCGAGGTCACGATCTCTTCGAGCTCGTC
GTGGTGGCGCAGTTGCTCTTCGCGCACTGCCAGCTGGGCTCGCAAGCGACCGATGAAGCGGTTCAGATCTTCTTTGCGGCGGCTGAGCTGGTTCAGCACT
ATGTCCGCTGG