Description :
From Genome Similarity Track
Location :
Scaffold_431:11808- 15273
Sequence
3465 bases(100 bases per row)
ACGATTCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTATACCCAACTGGGTTCGTCATATCCACGCCAATACACTAGAAATTCA
CGGTATATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTGTGCTTCGAGATCCACATTCCAACTATCTT
CCTGTAGGAGGACTTCGTCGAAGTCAATGCGATCGGATCGATCCACTGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGA
TACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCAT
AGGTGGGCTAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCAATCCCACTTGAATTTGATGTGGACGGGCGTCTTCGTTGT
GTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGG
ATCTCGGTTCCTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGG
ATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCG
TGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCGTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGTAA
GAAATCAGACATCAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATGGTTTGC
GCAGTTCTAGACGCACTAGCTTTGGCTATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGG
GGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTTGCTTGGATATTCCCAGGTGACCCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTTTCACAATC
CACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTAATGTCCG
CCTTCCAGGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAATCTCATCAATCCATCTCGACCCTCGTGGACTCTCTTCG
TAGGGGGGGCAATAGAAAAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACAT
CCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGCGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGCTTCCTCGAG
GATCTGGGGGCTGGATCCAATCCGTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGAATCCAACTACCACCACTTCGTCTAGTCGA
TTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACGCCGCATTGATTCCGTAAAGCGGCACCGGCCAAGCTATCCGCACTGGCATTCC
ACTCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAATAGTGTTAGGGCCGGGGCCTTGCAGTCAAT
CTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGCCCG
TTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGAAGTCTCCACAGTATTGCACTGTATGCTC
CTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGG
CTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCAATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAA
CATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAACGTAGAGT
GCCGGGTCAGGATCCGGATCTTCCCATCAGCAGGTTGTAATTCAGATCCAATACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCCCCGTAGTTCAGT
TCATACGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCCTGTACCAGAGCTGCTGAGACGGCCCAGTCACTGGCATAAA
CTATAACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCTTGTTCCTCAGTTCCATGAATGCGTGTTGAGCTCGGATCCA
CCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCGGTTTTAGGTCC
TCTTCTGACGCCGTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAG
CAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCTAGAAGGATTGCAT
CGCCCGTAACGACTGTGGGAAGGACAAATCGACTAATGAAGACAGATCCTTAGGATTCGCCTCCAATCCCTCCTTGGACACCCGATGGCCTAAGTTATCC
ACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTTCAGTAGGGATGTCACTCTCTCGCACAACTGATCCC
ACGATTCCGCTGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCAC
TTCCGTATGGCCTTCCCCGGACCCACCCGTTTCGGGCTCCGGTATCCGGGTAAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGAGGTGCG
TTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACTGTGTGATGAATGCGGATAT