Description :
From Genome Similarity Track
Location :
Scaffold_108:118040- 119161
Transcript NameFunction/comments
Phyci_95961hypothetical protein

Sequence
1121 bases(100 bases per row)
AGTGCTGTCATTCTCAAATTCACCTTTTCCAGTTAAAGCACCTCAGGACTACCGCCAAAGAAGACTCTATCGCCATGCAGCTCTTCACCCCGCTAGTTGT
AGCGTTTGCGCTATTTTCCGTCAGCGCCCAAGCCAAAGTGAAAGAAGAAACCAAGTCCATCGACGACCTCTACGCCGAGGCTGTCGCCGAAGGAGGGAAG
TTGGTCCTGTACCACGGAGGTGACACCCCGACCCAGCAAGACTCTCTGCACGACGCTTTCGTGCAGCGCTTCCCCGAAATCAACTTCACTCTCAttgtcg
actacagcaagtaccacgacgttcgtattgacaaccaactcgagaccgacaccctcgttccggacgtcgtggccctgcaaacgctgcaggacttccctcg
gtgggcgcgtcagggcaagttgctcaactacaagccgaaggggttctccaaaatccacaagtccttgaaggcgtctgacggtgcctggatggcgtacacg
gtgtactcgtttgcctcgagctacaacgcgagcaacctcaatggattgacaccgcctgccaccgtggaagccctggcggacccgcagtgggccggcaaga
tcgcctcgtcgtaccccaacgacgacgatgccgtgctgtacctgtacacccgctacgtggacgagtacggctgggactgggtggccaagctggctaacca
gagtgtcgctttccaccgcggctccaacgttgcgggcgaactggtcaccgccggagagaagttgattggcatgggcacGGATGTCGGCGTCAGCGTCGTG
GGTGGCAACAGCACCGAGTACATTGCGTGGGGTCAGCGTGCTGCCATCCTGGCCAAGGCCAAGCACCCGGCTGCTGCCAAGCTATTCATGAACTGGGCTC
TGACGGACGAAGTGCAGTCCTCGACTGTTGCGCCGAGCGTGCGCACTGACGTCAACACTGACAGGCCTTGGGATATCCCCGAGGCCAACATGGCTGGCTT
CTCGTCCTTCATGGAAGACCGCGCGAACGTGGAGGAGTGGAAGCAAACTTTCTCACTGTACTTCGGCGAGGTGCAGGGCAAGCCAACCCCGGGCTTCCTT
GGTCTTTACCCTGGTCTGTAA