Description :
From Genome Similarity Track
Location :
Scaffold_184:11803- 12982
Transcript NameFunction/comments
Phymu_g6268sterol 3-beta-glucosyltransferase, putative

Sequence
1179 bases(100 bases per row)
GGTCCGCCGTCGCTACCAAGAAACGCTTCCAGGTCGGCAGATGGCGCGTAGGAGCTAGTGGATTCACCGCTGAGGGTCACGGTGCCGATGACGTCGTAGA
GGTTTCCCCAGTCTTCCGGCTTGGGCACGAGCGTCGGGCTCCACATGAAGGCGTGTGGGATCTGGAGGTCCAGTAGCAAGTCTCGGCCGCCGTCTCCATT
GCGAATCTTGCGAAGCTTGAGCACCTTGGTGCGGAACTCGTTGATGAGACCTTCGGTGCCCTGCCACATGAGCAGGTCCACCATCTTGTACGACAGGTAG
TTGCTCTTCTTAAGCTCGTCCGTATACGGCATGTTGGCGAGTGGGTGTGGGAACGCCATGGTTGGAACCCAGGGCTGAGGGAACATAATATGCAGCGGCA
CACCGAGGCGTTcggcgacgtggacgtgcCCGTAGGAGACGGGGTTCGCGATGATAGCTTGGGCCTGGAACGGCCGCCCCGGGACGCCGGCGCCACCTCC
GTCCGGGTCGGGTGCTGACACCGCCGGCCACGTCGAATGCACAATCTCCTTGATGATCTCCTTGTTACGTGGTACGTCCTTGGTGAGTGTCTCGATCTTG
GTGGGGATGAGGTGGCCACCCGTCTTGACCATGTAGGCGGCCAGCTCCTTGGGGTCGCCGCCCAGCGGGTAGAACTCAACGCCGTGGCTCATGACGAAGT
CTCTGTAGACGGCGTGCGTGGCAAGGCGCACGCGGTGTCCGTCCTGTTGTAGTCGCTGTGCGATGGCTAGGAACGGCTGAACGTCTCCTCTTGTGCCGAC
GATAATGATGCAGATACGCATGATAGGGGGCCGCTGGATGGAGAGGGAGTTCGTACGGCTCTCCGCAGTAGAGCCCCATGCATCGCTGGGTACGATATTG
TCGACGTTGCTTCGCCGCATTCAAATAAAGTGGGAACTTGAACGCGAGATCGAGAAATGGAGTGTGACTGGCGACTGGTGTTTCGAGGACGAGAGATAAT
CATGGATATATATTTGTTTACCAGGGACAACATGTGGGTACGGACTTTGTACAAgtactactagtagtagtctactacatgtacttagGTTGGATTTTCA
TGCAAAAACAGCGCACGTCTGAAGTGGATACAGACTGTAACCTGTATTTGTAAGGTTAATTATTAATAACGCAGTATGA