Description :
From Genome Similarity Track
Location :
Scaffold_96:118013- 123290
Sequence
5277 bases(100 bases per row)
CGTTACACCTGGTAGCACTTTGTAGTCCGTTCAACGACCATGAACATGATGAATGATGGAGCGGAAGACTTCCTTCCAACGCACGAGAGCTACTCCCATT
TTTTTTGAGTCAAATATAAGGGTATGCCGTCGAACGCTTGAGTTCAACAATAGGGCAAGAAGCCGTTGGCGCATTGCTGTCCGCCCTGGGGCCAGACGGA
CAGCACGCCACCATCGCCAACTTCATTCAGAATGAACTTGACGTCGACCGGGAAAAGGTAACCTTGTTTCACCAACAAGGGTCTCAACAGACAGAGCTGT
TGAGAGAACATAGTGCTCAAGAGTTTGAACTGTTGAGGCAGCAGCAGGCCACTGCTACTGGGTCGACGTACACACGTCGACCCGGGACTCTAAAGATTGA
TATCTCAAAGTACAAGGGAGCCGATGAGGACTCTCTATTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATG
CAGATCGCATTTGCTCATTCAAACTTGGTAGGGCGTGCAAAGACGTGGGCATTGGGCCTTGAGTTACACGACTCATATGTCTTTGGTCGTAGGAAGTCTT
CAAGTCCCTGCTTAGGAAAAGTCTTGAGCCTCCGCGAGCGGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCGAGCAAGGTAAACGTGACGTACACTCG
TACATTCAGTACATACGTCACCTTATCAGTTGCATAAGAGTCGACCCACTGAACCAACAAACGCTGATCACGTTGTTCATGCAGGGTCTGACTGATGGTC
CTGTTAAAACCTACCTGTTCTGATTGGAGTTCAACACCCTCAAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAA
TTCGAATTCCTATCGTCCATCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAGCGCGAGGAGCGAGAGCTCTCATGTTAATAACTAT
AAGAAATCACAAAAATGCAATAGATGTCAGAAGACAGGGCATTACGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCACAGGAAACAGTAACC
GCCAAGCGGTCAAGAAGGGCCCGTGGCGTAAGTCCGACGCTGTTGCGAAAACGCAACACCGTAACGGACGACAAAAACGGTCAGGGTCAGTAGGTGCGGA
GCACCCTACCGATCCAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGAAGAAAGTTGCTCCCAACACTCAGTCATTGTGTGGTGCTGCTTCTGGTAATGAG
GTTTCCCTCATTACCTTGAAACTCGAAGTGACATAAGGCATGTCGCTTTGAGCTCTAGTCGATTGTGGCGCGCCAAACAACTTTGTACGACGCCAATCGC
TAGACAATAGCAAGATCAGATACATTAAGCGATAGATTTCTCCACTGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGT
AGTGGGTATTACCTATACATTGAAGGGAGTCCATTATGATGACGACTTCATCATATTGGACTTGGATGACAAATTTGATGCTATCCTTGGACTGCCGTAG
CTCGGAAGTTACGAGCCACAAGTCAGCTGGTATCGACGAAGTGTCGATATGCCCGCCGCTTGTTCACCAGACGCATATCTGATGAACGTCTTGGAGCGTC
CACAACCATGTGGAAGTGCTACGAGTGAGTGCGATGGCCTCAGTCGTTCTGTTGTTAGTACGACTACACAAGATGGTTAGTCACATTGTGGAGCAAGTTC
CCGGCGACTGCATAACAATGCAGGAAGCGCCGAAGGCCCACCACTCGAATAAGTAGAGCGGACAGGGGCATCTTTGCCTCTTTAATAGAAAACACCCAGA
TCATGACCAACCGATTGCCAATGATGGTCAATACGGAGATGGAATAGCCCAAGAGGCTAGAGTTGAGGGAATAAGTCCCTAACAAACAGTGGAAGTAAGT
CCCAATGAGATAACAGAGACATTGAATTTCCTGGTTAATGACGTATCAAGCATAGGAACATACCAACTTGATCTGATCGCGCCTCCGAAATTAACTTCGG
AGACCACTCAGTTACCCCCGCTCGAACAGAAAAGGTTATTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAGGATGAGTA
CGTCAATGAGATCCGATAGGCAATGTTCTTTGCCGAAGATGAACGAGTTCTCAGTAGCTCATCAATGGACGAAAGTGTTCTTGATGAGAAGACTCGAATT
GAGCGATATAAATCACAATCGATGGAATCGCTCAAGACAAATCCTCCCTACGATGATTTAATGGAATTCAGGGATGTACTCCCAGAAGCAGTGCCGTGCG
AGTTACCCAAGGATAAGGGTACTCGTCACGAGATAGACCTGAAACCAGGTTCAAATCACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACT
AGCGATTGACAAATTCTTTGCCGATCGCTTAGCAGCCGGTCATGCAAGGGATTCCACCTCTCCATATATCTATCTGACCTTCTGTGTGCGAAAAGTCACA
GGAGGGTGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGGAAGGATGTCATTATAGATTGTATGT
CAAGGAGTACCATCTTTTCATCGATGGATCTGATGGATGGGTTTTATCAGATCCTTATGCGCGAAAAGGACATTCCTTATACAGCAGTAAGCACCCCAAG
TGTTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCGACGTTCAACAGATGTGTTACGAATCTGTTGAGATCTGTGCGAGAA
TTTGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGCATGGACAGACGGATGTGGAAATTTACCAACTCCACGTCCGAAAGGTTCTTG
CACTGATGCGCGCGCATTAATTATACGCCAACCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGTTGCATCGTGGGTAAGCATGGCGT
CCGGACCGATCCGGAAAAGATCAAGGCGATCATTGACTGGCCGGTGCCTACCGACATAAAAGGATTTCGAAAGTTCCTTGGCCTAGCGGCGCATTTGCAC
AAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGGGAAAAAACGAGAAGTGGGCATGGAGTGATGATTGTCAGCGATCCTTCG
AAGGTATCAAGCAAAGCTTAATACGCTTGCCAGTTTTGGCGATTGCAGATCTAGACAGGCCATTCCTCGTGGTATGTGATGTCAGTGACTTTGCAATCGG
CTGTGCATTAACGCAGTACGATGCAGACGATGCGGAGCGTGTCGTCTGTTACCTATTTCGCCAGCTGCAACCAGCTGAACGCAACTACCCCGTCCATGAC
AATGAACTCCTTGCCATGAAGTACACGCTGGCGAAATTCAGAGTCTACCTGCTAGTTGATAGACCCTTCATCATTTATACGAACCATGTGTCTTTACGCA
CGGCCGTAAATAGTCCACACCGCTCGCAGCGGTAGGCGAGGTGGCTGTCATTCTTTGCGAAGTATACCTTCTCCGTCGAGTATAATCCAGGACGACTTAA
CGTCGTTGCTGGCGCACTCTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAATCCGACACTGGTCCGACCACTGTCGCGGTGTTGACATCGAGTGTCCCG
TCGTCAACCTTATTCGAAGACATACGCAAGGCGTACGATCCGACGATAGTGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAATCCCTTAAAAGGT
TGTCCCCAGTATATCGATCCTCCACGGATTGATATACAGTCCACAATGGCTTACTGAAGTATACAGTCGTTGCCGGCGACACGCCTCGTGTCGTCGTACC
GGACCATGGTGACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTATGGTGGACATCGTGGTCGAGAGAAGACATATCTCACAGTTAGTCGCG
ACTTTTACTGGCCCCGCCAGTATCATTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCTGGTCCTTCACTTCGTGCGCCGTTG
CAATCCTTGCCCATTCCGGCAGAATGCTGGGAACCAGTCTCAATGAACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACTGGTATTCTTGTGT
TCGTTGATAGATTCAGTAAAATGGTACCCCTGGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTGTCTTTATTGACACGATCTTTCGTCT
TCATGGGTTGCCTCGTGAACTCGTTTCTGATCGAGACCCACGATTCACTGCGGGATTCTGGCGATCCATGTTCAAAACACTCGGAACGCGCTTTTAGATG
TCGAAGTCTGACCACCCTAAAACAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAGGAATCCTTCGGGGTTATGTCCATTCGTTTACGAACTGGAG
CGAGTTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGTCGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTA
TCCACGTTCTTAGAATGTAACTCTAGTTTGAGGGGGGGGGAGGGACTCATTCGAGCGAACGCCAAGTCGGCTCTCACTCATCACGTACTGACCACGAGGT
CACTACGTATGAAGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAATAGCGAGGATGCTCTTACTCCCCAGGTCACTGATCTTGCCACA
GTGCGCTCCAGCGCATTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTGACTCGCGAAACGGTTTTCCGTTTCGTGCAAGATTCCATTGCTGA
AGCAGTGGACCGACAAAAGAAAAACGCAGACAAGAATGGAAGAGCAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGGTAAACTTA
CCTCGACACATTGTGACTAATGTGGGTAGTAACAAGTTAGTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCTTAGGCAACACATACACGATTG
AACTGCCACGTAAGATGCGCACGCATCCTACTTTCTACGTCGGTCGCCTAAGACCTTATCACCAGTACGGGACTTCT