Description :
From Genome Similarity Track
Location :
Scaffold_703:1180- 8057
Transcript NameFunction/comments
Physo_145243reverse transcriptase
Physo_109717serine/threonine protein phosphatase

Sequence
6877 bases(100 bases per row)
CAGGACTGCCTGGTCCATGACCGAGGATGAGTTCAACTCGGCCGACGTGGACTCCGGTCGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTAGCTCG
GCCAAGAAGTCCTCCATGGCGAGCTCCTCAAGGCTCAGCAACTCTGAAACCTCGGGCAGAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCGACTACCGG
TCACGCCGTCGAAGATGTGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAGGCTCGGAGTCGCTGGCGACTGGCGTCGTCGGCAACACGACTTGGCC
CGGCTTACGACGTGACCCTCGGGTGTCTTCGTCTTGTGGCGCCGCCTTGACGGCACCACCGATCTTCTCGATCTCGTGCGGAACTACGTTACCCGCCTTG
TCCTTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCGTGCGGGCAGGACCGACACGCAGACCGTCCATGAACACGGTCACCTTGATGTGTTCAGGCAGGGGG
TTCCCCACCAAAGAGGCAGTGAGCACTCGCATCTCCTGGATGTACTCATGCAGCTCGCGCCATCCTTGTTTGCAGGCGAGGAAGCGCGAACGCTGGCGGT
ACTCGTAGTTCGCCGGATGAAACGCGGCCCGCAGCTGCTCGCACAGCTGGGACCATGATGCAAAGCATCCAGGCGTCGTCGATCGCGCGTATACGCCCAA
CTCTTAGCGCGACCACTAAGGTTGGAGAGCGCAATGGCGACACGGAGTCGCTCGTCCGAGACGAGAGCCGCGTCCATCGCGAGCTCAACCTCTCGAACCC
ACAAGTGAAGGTTTTCTCCTTCCTTCCCTTCGAAGGGGTGAACCTTCAGCCGCAGGGGCTTCGGTTGCACCGGCTTCGGCGCGGCCGCAGTGGCCTGCAG
CCCTTGAACGTGGGCGATGAGCCCTCGCTCGTAGGTGTCGAACGCGTTGATACGCTCAACCTGCTCAGCCGGCGTCGCCGCCGCTAAGCTACACAGGGCA
TCTGTCCCAAAGATGCCTGCCATCTTACGAACGGACTCGTCCTGCGAGTCGTTCAGATGGGGAAACTCCGTACGATCCATCTTGGCTCACTCGATGAGAC
CACAGAGGATTCAGGTAGTCCAATCTACCCGCGTAGGCGTAGGATTGACTACAAGTGCTACCAAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAA
GCAGAAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGACTTGACTTGAAAAGCGGTANGATCAAAGACTGAATGTAT
TTATAGGTTGGTACAGATTTGGCCTGCATACAAATCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGCAC
GGCGGCCTGTCGCCCGAGCTGAGCCAGATGGAGCAGATCAAGCGCTTCGTGCGCCCCACGGACGTGCCCGACACTGGCCTGCTCTGCGACCTGCTGTGGT
CCGACCCCGACAAGGACATTATGGGCTGGGGAGAGAACGACCGCGGCGTATCCTTCACGTTCGGCCCGGACATCGTGAGCCAGTTTCTCAAGCGCCACGA
CCTCGACCTGATCTGCCGAGCCCACCAGGTGGTGGAGGACGGCTATGAGTTCTTTGCCAAGCGTCAGCTGGTCACGCTCTTCTCAGCACCCAACTACTGC
GGCGAGTTCGACAACGCCGGCGCCATGATGTCTGTGGACGAGACGCTTATGTGCTCGTTCCAGATCCTCAAGCCTGCGGAGAAGAAGCAGCGTTATGCGT
ACAACGGTCTGGGCACGCAGCGTCCGGCCACGCCGCCGCGGAAGTAGGAAGAACGCTCGAAGAACGCCATGCAGATTTCGTTAGGGTCTGTATTGTGCTA
AGCAGCGAGGGTCGGCCGGTCGGCCGGCCTGCATAGTCATCCATCCCCATACATGTGATTTGATTTTATCGATATGATAGCGCGAGCTCGATTGATTGAA
CACGCACCCCCGTCCTCCTCCCTCCAGCAGAGTTAATTGCAGCAAGGTATCGACCGCTGGAAGCTCGCCACGGGGTGCTTCAACGTCAATAAAAAGCAAA
TTTGACTACTTACGGGTGTGTTAGCTTTCTTGAACTGTGCCCTCCCTCATACTACGTGTACTTGCATAGAGTTGAAGAGGAACGCGAGGCTGTATGTAGC
TCCTGGATGCACTTGTGAGCGGTGAGTCGCCGGCGACGCCAGCCACTCAACGGACAACCAGACGAGGCTGACGTCATGCTGCAGGCACCATCAGCTTCCT
GAGCATTCAGATGTGGACAGGCAGAGATGATGCCGCGCAGTTTTCACGGCGCTGCCCGACGTCGCCCGAGAAAGCCGATGGGTTTCCAGCTCGGGCAAGC
GATCCGCTGATCTGTCCGACCAGGCATTTCAAGGCCGTGACAAGGCGATGCCGCGATGTCGAGGACTCCAGACACCCAGCCGAGCTTGTCGTCGTTGGCT
CGACCATTTCAATTTGACAGCTCGACAAGCACGTCACCGGATTTCTGCCTGGTCTTTTCGCAGATGTGTAGGAGTGC