Description :
From Genome Similarity Track
Location :
Scaffold_684:1180- 3014
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_684-snap-gene-0.3Myosin

Sequence
1834 bases(100 bases per row)
ATCAGTCTATCCTTGTCAGTGGCGAGAGCGGTAGTGGCAAGACCGAGTCGACGAAATTCCTCATGACGTACCTCGCTGCTCAGGCCGGTGGCGCCATGCC
ATTTAACCCGGGGCAGTCGCAGTCGGGTGTCCAACAcGGCATCGCTGCCAAGGTGCTGCAGACCAATATTGTGCTCGAGTCGTTTGGCAATGCGCGTACA
CTGCGGAACGACAACTCGAGTCGCTTTGGCAAGTTCATTAAGCTCCATTTCACCAGCACCGGGAAGCTCACTGGCGCTAGCATCCAGACGTATCTGTTGG
AAAAAGTTCGCCTCGTGTCGCAGTCCAAGGGCGAGCGCAACTACCACATTTTCtATGAGATGTCGACGGGCGCGTCACCAGCGCAACGCAAGCGGTGGTG
TCTTGATCCCCCAGCGTCTTCCCACATGGCGACTGGTGATAGTGGAGACCTTCCCGAGTCCATGCAACAGTTTTTGCATTATCGATATCTGAATCAGAGT
CAATGTTACAAGCGTCATGACGGCGTTGACGACCGCGAAATGCTGCAGCGAGTGGGGGATGCGTTGGAAGTCGTGGGCTTCACGCCATTCGAACAGACGG
GAATTTTCGACCTCTTAGCAGCATTACTTCACATTGGTAACCTCACATTTGAGCACGATGAAAaCAGCGATCGAGAGTCAAGCGCTCAGCGCATGTCCAG
TACATCCACAGACcTCGCACCACATTGCATCTGGTCACGCGACGCGGCTGCTcGCcTATTGCAGGTTGATGCCATTCAGCTGGAGCGCGCaTTGAGTGTA
CGCAAGATTCGAGCTGGTACCGACTTCGTCAGTGTCAAGCTATCAGCTGAACAGGCCAATAATGCCCGTGATGCTCTTTCCAAaGCGTTATATGGACGTC
TGTTTGATTGGATGGTGGACCGAATGAACGAGTTTCTGAAAATGGACGATGCACAGAAGTCAAAaGGCCATTTCATCGGTATCTTGGACATCTTTGGTTT
TGAAGTGTTtCCCCACAACTCTTTCGAACAGCTGTGTATCAACTTCGCTAATGAGACACTCCAGCAACAGTTCAATGACTACGTGTTCAAGATGGAACAA
CAAGAATATGAAGCCCAGGGAGTGGACTGGAAaTAcGTTGAGTTCCTCGATAACCAGGACTGTGTCAACTTGATCTCACAGAGACCGTTTGGTATTTTAC
CTCTTGTTGACGAAGAATGTCTCATTCCGAAAGGCAATGACACCACATTTGCGTCGAAGGTGTACAAAGCGTGGGATGACCACGgTCGCTTTTCTGCtaC
CCGTATCCAGAAGGCAGGTGGGATGTTCACGATTGTGCACTATGCTGGTCCAGTTGAGTATTCCAcgCGTGGGTTTTTGGAGAAGAACAAGGACACTTTG
CATCAAGAAGCTGTCGATCTGTTGGTATACTCCCCTCGTGAAGGTAGCTTTACGCGTACGCTGACGGAAGGGAGTGCGTTCAGGCCGCGTGACAAGGCAT
CTCCGCGCCAGCGAGCTGCAGCTAGCAAGCAGCGTGGTGCAAGTGTTGGTCTACAGTTCAAAGAGCAGTTGACTGCGCTACTGGAGACATTGCAGCAGAC
GAACCCACATTATGTTCGCTGTCTCAAACCTAACGAGGAGTGTGAGGCCCGTTTATTCACTCGTGATCGCGTTTTAAACCAGCTCAGATGTAACGGCGTC
ATGGAAGCCGTCCGCGTTGCTCGCGCAGGTTATCCGATTCGAGTGCCTCACGAAGAGTTTGTCAGTCGATATTTCTGTCTAAAACGTGTCCGCAACCCAC
TCGGCACCGAGAAAACGCCGTCCCTGCAGTCTCT