Description :
From Genome Similarity Track
Location :
Scaffold_3598:118- 2502
Sequence
2384 bases(100 bases per row)
TCAAACCATTGGCGGATCTGGTTGTAGAATTTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAAAAGCAATGTAATGG
ACCCCTCCATTACATAAGTAGGTATATTTCTTTACATAAGTAGGTGCATCAGCACACGACTAGCGTGTGCTGAAATGCTGTCATGCCATTGGCTGATATA
TGGGGAGCCAGACTCATTATTAGCCAATTGGACTATGACGTGTATTTGAGTGGCCAGGGCTGTGGCCTTGGTCCTAAAATAAAGTCAGAGTTGATTTTCC
CTAAACCTAAGATTCAGTCGTCCTATTGCGAGCTTCCTCAACACTATAGTGTAAGCAAGTAGCGGAGTAAATACCTGGCCCGTTACAAGCAATGATCCCC
GAGATGACCCTTTTTGCCACACTTTTTACAAACCAGATGTTTCCCACATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCT
GTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCCTCGCCGTTCGATCGTTGG
ATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTAGGTGAACACG
TCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCACCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGC
ACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCC
GCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCG
GCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTG
CCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACT
TGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCAT
GGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGGAGTTGTCT
CCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGAC
TCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATT
ACCTTGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTGGGGCCTACTGGATCC
CGAGCCTTCGCGCTCACAGGGACTTCCTGTCGTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGA
CGACGTGTCTGACTCATCCTCAGCGGCGGATCGTAGTTCGAGGACGCAGCTTGGCTGATCCTTGGCGACGACAGTGCGCGACCTTTCTCCGGTGATGGAC
TTAACGCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACT
CCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATT
CAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCA
GCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTA
GGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGAC