Description :
From Genome Similarity Track
Location :
Scaffold_1817:118- 2271
Transcript NameFunction/comments
Phymu_g13669hypothetical protein
Phymu_g13670hypothetical protein

Sequence
2153 bases(100 bases per row)
ATTGCTTGACCTAGGATCCCAGAACATCTCAACCCCCCAAGATCCCCGCTACAGGAGGCGGCAAGCAACAAGTTAAAGGAAAAGGAATACACCCCCAACA
AGGCAACCCCGGGTCCAAGGACCCACAAGATCTACGAGTCCAAGACCAAGATCTACCCCCTACCCGGATCCTGTGTGCAGGAATACCCACGCAAGATCCA
ACCTCCCTGTCCCCGCCGAGGACGTTTCAAGCTTCACACTACTTGGACACCCTTCTCATCCGCAAGAGAGCAGATCCCGCCCACtgacgggtacacaagg
tgagcCTCTCAGCAACCCCACGGTTATCGGAGtaccccctccgttagtcaGTGTCTGGGCGCCGTGTGTGAGTGTAGGATCCCTGCTCATTCCAGCGGAT
CCATTCCACCACAATGGTGCGCGTGCCCGGATCTTTTGCGGGTGACGGATATCACCGTGATTCTGAGGAAGATGttcaagtgaagaaggaacCGGGAGAA
GAAGTGCCGACGGTTGTTGGATCGCCATCAGCACCGCTGAACGCGAGATCCACGGATCGACAGAGTTTTGGGAGGAGCTCTGTCGACAGGAAGGAGGCGA
GTCTGGCGACGGACGCGGAAGAgaaatctcctcctcctcctccccagGTCCCTTCGGGGACCCCTGCGGATCGAAACGCAAGTTTTGATCCGCCGGGTGA
AGACCCGATGGCGAAAGCTATCggatcttcatccaccaccaccaccgcgAAGGTCTCAGGCGCcaagtcgtcgaagaagaaggcgacgaagacctcgcgg
aagaagctcaaggcaCCAGAGTCAGACTCTGATGAGAAAGCCCCCACAAAGGCGGAGTGGACGTCGTCCAAGATGGAAGCCGCCTAGCAGCAAGTCGCAC
TCGAGGGCTTCCTTCGGGACGACCCGGTGATGAAGATCCTACAACCCCAGTTGCTACTATCTCTCACGGGCCCCGTGCTGGCGCCTGCGAGTTCCATGAC
TAGCTTGGACTGCGCCTTGGAACTCCTTCGGCTGTTTGAGGAAGCCGGCTTCACGGCTGGAGCGTTCGACGGCGAGACCCTCTtccgtctcgatctcgac
cTGATCCGGACGGCGGCAACTACGCTCTTCAACCGACTCAAGCCTTTGGTCGGTGAGCGCAGCGTGCCTAAGAGgcgcaagaccaagaacgtGCAGGTGC
ACTTGCCGGAGTACCAGACGGGGTCGTCGCGGTACGCCTCCGCGGCGTCGGAGGCCGGTTCAGACAGCTCGTCTGAACCCCGTCGTATGTCGTTGGGACC
CACAGGTTCTGCCATGCTGCAAGCTCACTTGCCGAGCAGGACCCTTGACCCGGCACCCGTGTCCGCCGCAGTCAACCTCGGTCAACTGCCGACTCGAACA
TTGGTCAAGGACCCGCCACACGAGTCAACCGAGAGGCTGGAAATGATCTTCCAGTCTGCCATGGATCGGTTCTTAAAGGAGCGACAGCTGACCGCCGCCC
CGCGGGCGACCGCAACGTCGACGCGCCCGAAAGTCCTGGACGTCGAAATGGAGTCCACGGGTTCGCATCCCGACAATTGGGAGTACGACCCTGACGACTT
TGAGGGAGCAACCCCCGGCGCACGCTCGCGACGGCTACAGCCGCAGCTGCACCCACAGCAGGAGGCAGTGTGATCCAGCGCGTTCGAATCTCCGCGATCT
CGGACTTGAAGGAGTTTACAGGCAAGgatcatgacgaagaacgagcaaGAGCTTGGATAAGCAAGGTCAAGTCTGCATTCTCAAGGGATCAAGCCTctga
cgaagagaagtgcCTAACCTTCGGAGATCTGCTCACGGGCCCGGCGAGGAACTGGTACCGGCAACTCGGCCGGTCGACGAGGCTGAAGTGGAGCGAGCTG
CTGTAATCCTTCCAGACACAGTACTGTGGCCTTGGTGTGTCCGTGGCCTGGCAGTACTACCATGCGCGCAAGCGTTCGGAGGAGTCGCCGCTCGAGTACT
TGTACCGCCTCAACGTCGCCGGCATGCGTGCCCACGGAGGGTCaaggatggagacgccaaGTCCCGCCGAGAGCATGTCGAGCACTCCATCGAGACGCTC
GGCGATCAGGATCTCGCAGACCAGCTGACGCTGTTGCGGCTTGCCGACGCCGA