Description :
From Genome Similarity Track
Location :
Scaffold_113:118- 2141
Transcript NameFunction/comments
Phyci_13367Hypothetical protein

Sequence
2023 bases(100 bases per row)
acgccttccagtgctcggcccacttggacgtgtgcaccatgctggcgtcgttggcgcggtagccccaaacgggacccgtcgacacgtcggcggacacggt
CAGAGCGCAGGCAGCGACGATAGCGGAGATGGAGGCGATGAACTTCATTTTGTCGGAACACAGTCGGAGGAAGTGAGGCGAGGCGAAGTGCTGCGTTGAG
AACAAGTTGAGGAATGAAGAGTTTGAGCGAGTCTCCATCAAGGATCTGTCGGTCGTGGTTGCGATCGAGAGCGGCGCGGCGCAAACGAAGAGCCCATTCG
GGATTGGGAACACCTTGCTGTTGGCGGAGTTGTGGCAATGCGCTTTTCTTGGTACTGTAAGGACAAACTATAATCTTGTTTTTGAAGTTGTTTTTTTGTC
GTTAGTCTGGAACCTGTAATAGTAAATACCGATACGGCAAGTGCATATCATATTGTTGTGAAAGTGATAGTTTCGGTACAAACGGGCTCTAATACATCAT
GGATTCGTGAAATTGATACTCCAGGTGGATCCGTCTCATTACGCAACCTGCTGGTGTTTTCCCGTTGGCCCTGCCTTTGGCAAACCAGCATATGGCAAGA
TTAACTGCCTGCGCACAAACTGGACGCGCTTCCGACATGTGCTTCCAGAGAGCTCGTTCCGATCCAGTGGCAGTGGCTGCTTGCCTGCCCACTTCGACGG
GGTGCATACTTTCCTATAACCAAGCGCGGCAGACTTTTCACCCGGTTCCTCGGAACCCCACGTCACGCGTATGGTCGACGTAACGACAGGAACTGTCATC
GTAAATAAGGCGAGCTGCAAGACGTACGAGATACCTTGCTTGTTGAGAATGAGCCCCTCGCAACGAGGCTCTTTGCGTCGAAAGCGAAGGAACGCATGAG
GGGAACGAAACACTTGCCGTAATATACGTATAACTATGCCCACACTAAGACGAGTCGACCACCAAGAAAAGCCGACCAAATCTTCATGGTACCAAGTGCG
TTACTGTAGACGGATACTGTAACATATCGGTCAAGCTCCTCGGCATGCCCCATCGCCGTATACAGCGCAGGTGACGTGAAGCATTCGACTAGTAGGAGTC
ACGGTCGACTACAGCCGCGAAATGATCATTGGAACAAACGGGCCTCGTGGCGGATTGCTACGCTGCCTTTTAGGTACATGTATATCTTTTCGCCAAGTCG
CAAGTTGAAGCGATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN