Description :
From Genome Similarity Track
Location :
Scaffold_131:11797- 14958
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_131-fgenesh-gene-0.3HCG3 protein (Predicted)
Pytve_DAOMBR484maker-pve_contig_131-fgenesh-gene-0.4DNAJ

Sequence
3161 bases(100 bases per row)
GACTGGCGGATGTGCGCCTCCAGTTCGCGCGCGGCCGCGTCGCTGTGGGTCGAAGCGTCCGACGGCGTCGTCTTGGTCTCGGCCAGCGCCGCGCACAGGA
TGGCGGCGCTCACGAGCTCCGTCTCGCTCGAAGGCAGCGCTTGGTCGTCATCGGAGCGGGACGGCCACCACCACGCCCGGTCGGACGCGCAGCTCGGGTC
CGCGTGACGCATCGAGGGCGGGCTGGTGTCGGTGTCCGAGGTGGCCGAAGCAACTGTGCGGTGCCGGCGGCGAGGGCTCAGCTCCACCGGAGAGCGTGTG
CTCGTTCTCTTGGCGGATCTGAGTTGGCCTTGCGCATTTCGCTCCTGGGAAAGGTGATTCCTGGATTGTGGGGCGAATTTTTTCGGCTCTTTTTTGCTTT
CCTGACGCAAAACCGTAATTGAAGGCTAGGAGTGATGGCTTAATGAGGTGATTTGTATGTGGGTGAGAATCTGAATGATGGTTTATGATGGACGCACGAA
ATAACGAACGAGGTCCCTCCCACAAAGCCAGAGAAAGATCGCGAGCGTCATTTTCTTCCGCAAAGTTTGCCCATTTGTTGATGGATACGCATGAATGGCG
TGCAATACATGAGCATTGGTGACTTCAGTTCGGTGAGGCTGATCTCGGAAGAGCTGAACGCAGCACGAAGACAGCACGAAGACATCGAACCTGGTGCGTT
AGGAGTTACGCGTACTTCAGTTATATCTGGCATATTATAGGTGGCGGGTAGTGGCAGGAAAGTGGACATTTTCAGTGCCCTTCGTAATACTAAGAGCTCT
TTCAACTATCCAACCACACCTCACTGACGTTTAGCAGGGGTTGGAGCGCTGTTCTCGAGTGCCAAGCAGTGCAGCTCGGAGTGCTCGAGCGCTTTCCCAC
TGTTGGACGTCACGGGAATGTTCTGCGACTGCAGGAACCGTTGCAAGCCTTGCGTTGACATCATGGAACACATAACGTCCAGCCTCTCGTCGGTAGCGAC
GTCCTTCGACCCCTTGACCCCCGTCGACGGCGAGGTGGAAGATTTGCTGGAGTCCTCGCTGTTTGGCACACCCGCCTTGTCCTCCTTGTCGCCATTAGGC
TCGTCACCTCCGTCGAACCCAAAACCGTCGCACACGATCCCACCAGCAGCCTCGACATCGGCGAGCCCCGCATGCATGGCTAGAATCGTCTTGCGGGCCG
ATTCGCGCACTTCATCATCGTCCGATTCCAGTTGGTCGCGCAGCTGGTACGCGTCATCCGAAGTGAGATAGCCCGCGTTGACCAGGTACTCCATTTGCGC
TTTCAAGATGACCAGGTTCTCTTGGTCGTCGGTTTTTGCGGCTGGACCGACTTGACTCGTGTCAGGAAGAGCAAGCGGCTCCGCACCAACCAACTTGAGC
GTCGACCGCACACCGGGATACATGGTTGCCGTGACCATAGAAGCCGTCCCGATTGTCTCGAATGTCGAACGGGCCGGTTCCTCTAGAGCCGACTTCCCAT
ACGAAAAATACGTCATGTAGCTCGCCCACCACGTCTCGCCAGCGATCGGCTCGGTCAGCTTCTTGGACTCTTCGTGCTCCATCTTTCGCAAGGACTGGGC
GGCTTGCGTACTCACCCACTCCCAGAACATACTCCACGTGACAGGGCCTTCGAACCCGTCGTCCTGAATAACCGCCAGCGTGCGTTCGTATCCGCTCTCT
GACACCGACCCTGAGGCTTCGAACAGCTTGGTCATGATGCGGACACAATCATCCTTCGAGATCTCGCCAGTCCCATTCGGATCATACTCGTCGAACATAA
GACGCGCGCCAAGCTCTAATCGATCGATATGTTCTTTCGCATGCTGCTGGCTCGTGAAATACGAGGAGGTCGATGCGGTGTACGCCTTGGTTCCCGCAAA
GAAGCCCAACATCCCGCCAACAACAGCCGCACCGGTAGCGGCGACGATCCCAACCGGGCCACCCGCGATCCCTGCCGTCGTCCACATCCCGAGCGCCGAG
GCGACTCCATAGGCTCCAATGCCAGCGCCAGCTGCCGCTGCCGTGCGACTCACAATCACTTCGCCCATCCGCAGCCGAAACTCCTTCATCATCAGTCCCT
CGCTCGTCCTCGACAAGACACCGAGCAGTTTCCGGTCCGCGTGCTTCTTGCGGTAGTCATAGTACTCCTTCCCAACGTCCACCAGAATCGACGCGATGGT
CAACGGAGCAGCCACAGCGCCTCCGAGCGCAGAGGTCGTCCGAGCCATTCCGTTCGCTAACGCCACGCCGCCAGCCGCGCGGATGCCGCTGTCAAGCGCT
CCATCAGCACCTGCGGTCACGAGTTCTTTCACAGTTCCGCCAGCATTCTGGTCTTCGAGCTGATAGCGAACAATCACGCGGTCGGCAAGCGCTGAGCGCT
TGGCTTCGACAGCTTCGCTTGCAACGTTGCGAGCTAGTGCTGCTCCGCGCGATATGTCCGACTTTTGAATATAACCAACCATGAACGGCGGCGGCCCGTT
GAATCGCACAACAGCTGACGACTCACCATCGCGCCAACTCTCCATGATCCCCAGCCCGAACGGCGTTTTCACAGCACAACCAATCGGGTATGCAATCGCC
TCGCCGTTGGCAGCTTGCGAAGCCTGGACATCAGCGCAGTCTTCGGTTGTGACTTCTCCAAAATGAACTGAAATCTCCTCCATCAAATCGACACAGTCAA
AGAACTCGTCTTCAGCGAGGGCCTCCATCGACGCATGATCGAACTCCGAGACACAATCGAAGAACTCGTCAACAAGATCCTCTTCTTCCTTGTCCTCGCG
CTGCTTCTTCTCGATGATGGCTTGCTGCGCAGCTCGCACAAGAGCAGCCTTCGTTTTGCTATCGTCATCTCCAGAGCCGTCGCTAACCGTAGTGCCTTTC
TTGCTTTGTCGTTCTGCCGCCTGCTGTAGAAGCAGCTGAGTGCGATCAACCGACTGCTTGGAGCTTCGATGATCCTCAAGCAAGAGAAGCAAGCACTCTC
CTGGCATATCGCGGACCACGGTCGCCTGGTGCTTCTTCTTCGAGTTCTCGGTGTATTGCGACCATGCGCTCACAATCAGCGCCACACTAGCGCCAACAGC
AACAGCCCCGCCAACCACAGACATGGTGCGCAAGCCTGTGCTCGCGCTCGAATTCGGCACA