Description :
From Genome Similarity Track
Location :
Scaffold_653:11797- 12894
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_653-snap-gene-0.8ATP-binding Cassette (ABC) Superfamily
Pytve_DAOMBR484maker-pve_contig_653-snap-gene-0.6Phenol hydroxylase

Sequence
1097 bases(100 bases per row)
GAGTAGCTTCATTTTCAACATCCACGTCGAGTTCTACTTGATCGAGGTCTCCACCGTCGTCCCCTGCAACGATGCTCTTCACCGAAGGAAACGTCATGGC
GTAGTCGATACCGACAGCCAGCGCGCCATAGACGATCGTGAGGATGACGAGATAGATCATCTCGTAGCCCATAATATCCGTGCTAAACGGACTCGTCTTT
GTCGTCCTGGAGCTCTTGATCGAATTGGCCTCGTTCAGAACCAAGTTGAGGAGGCCGTTGCCGAGGTCGAACAACGGCGACAGCCGCCAGAAGAAGACCA
GCACCGAGTTGACGCTCTTGGTCGAGTCGATCTGGTCCAGAATGTATGAGACGACCATCAAGACCACGCCGATCACCAGGTTGATCATAATGGTGTACGT
CTGCGAAGACGCATGCTCCTTGAAGAGATACGAGAGGCAGTAGGTGAACGGACAGACCGCGAAGCCGAACAAGACGAAGAGCACAATCACAGCTGGGAAC
GTCTCGGACGTGCAGCTGTAGCACTCGCTGCTTCCCGTCATGGTCGAAATGTCGAACGCCTTGATCAAAATGAGCGCCGAAGCGAACGGAATCACGTACA
CGAGCAAGTCGTACACGTAGTTCGAGAGCCAAAACGCGGCGAGAGAGACCCCAGATACGAGCTGCTGATGTTTGGAGTTGTGCTCAGCCTGCCTCTCCTT
GACGAGGAAGACCACAATCGAAGCCGTGAAGTACGTGAACGCGATCCCGATGAAGACACAGGCCGAGAACGCCATTTGGTTTCCGAACAGTGTTTTCGCC
GATGCAGTCAGCGGCAGCGGGTGGTTGTTCACCTTGAGCTCGATGCTTGCCGCAGCCGAGTCGGATAAATTCGAGGCAAGGAACCGATACACCGCTTGGT
CCATCAGAGCCTTGAAAATGATCGGCGAATGAGCTGCTGTCGAGTTCACGAACACATTGTAGCCCAGCACATTGCGATCACTATCGCCGTAGATGAGATA
CGCGCCGTACTGGTCTTGCACTGCCGTTGAGCCAATTCCATATCCGCGATCGTAAACCACTTCACCCAAGCGTAGACCGTAGCCGGTCGCATCAGAT