Description :
From Genome Similarity Track
Location :
Scaffold_38:11796- 13295
Transcript NameFunction/comments
Phyca_LT1534508749autophagocytosis associated protein, putative

Sequence
1499 bases(100 bases per row)
annnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcggcgcaatggagaagtggacgctccatctcgggatggagcctacatccatggtctcttc
ctcatgggtgcgcgttgggacatccagaacaacaccgtggataggtcacaccccaaagagatgttttcacccatgcctgtcatcaattgcaaggctgtgg
ctgccgacaagcttgatgtcaagggctcgtacgtctgcccgtgctacaagacggaattccgtggaccaacgtacgttttctcggcgcaactcaagtccaa
gtcaccacctgcgcgctgggttcttgcgggtgtagctcttatcatggatattgtgtagttattctctttactactaagcgtacttcatatatttcagtcc
aggttcagtaacgttaacaacaataacgatcatgaatgaaacatagatcagatctcaaatttgtacttcatgtttatcgcccttgttgacgctggatact
gccaacttgaccaaaaaattgtgcgagttttattctgaggcgttcatttttccagatctcgcttgccacaactatgtgattctttttcgttgttccaccg
accacacgctacttgaagagtgtcgaacatggcggcaacaatcccggaccagtccgtcaccaggggctaaaccagcgagaaactattcctgcggcaagac
gctgaaaagtgacaaataatttgtcccattagtacaatcatgagttggtagttacttcaggtatgcattaccaaaatacactctattgcagttgtctagc
gcgtagcttgtgctgcttccacagtccaagcgtgcccttcgccgacggtgtaagcttcaactcatccctgtaccatcacatcaaacattagcctccctta
taaattgaaacacccccaaaacatctccatacagtgtcgtagacccctccgccaacaaactctcagcagacaaaagctccagcttcacggactcgaactt
gtccaacggtccaactcgatacagatcctttaactcttccgccgagcactccgttttaatgtggaaagctgcaacaattgcaacggatttcacaatgat