Description :
From Genome Similarity Track
Location :
contig_31:117917- 119795
Transcript NameFunction/comments
g7467.t1RAW27207.1 hypothetical protein PC110_g16392 [Phytophthora cactorum
g7468.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GTCACGAAGGCCTTCTTCCTGTCCTGTTTGCTCACCCAAAACTCGGCCAGCTTGGCAGATGTTCGGGATGCAAAGTCTACCTTGGTAGGGTGCACACTCA
TATCCGGGAACCCGTGGAGATACACCATGACTTCGTCGTAACTCTCAGCAGCCTCCTTGCTGACGTCATCCGGCGTGGCTAGAATCGCCAGCAAGTTCCT
GCTCACCCCCGTTGCAGTCTCAGTCGCTGGCACCTTCACTATGACATGACGAAGCTGCATGGCATCAGTATCTTTATTTTTCTACAAGCCCAACACTATT
GGAAATGAAACACTGCCGTCGCGTGACTTGTTTTTTGTATGTTGAAAATTTGAAATTTGTTATTCCTTTGGTAACTAGGGTAAGTTACACAAAATTGTAT
TTTCAGAATTGAACACGAATATGCCTCCAGTGCCGCCTGGACGCCGGGGAGACAAGGGCGCTGCGGCGTCCACGGGGCCCGACGACAACGTGCCGTGCAA
CTACTGCGTGGGCATCAGCATATACACCAGGTAGACGCTTCTCCGGTCCAAATGCGCCCTCGGGTTATGCCAAAATAGGTACTAAATCATAATATGGTGG
AATTATTTAGAGCCATGTGGAAAGAACGTCAAAGCCCTGAATGCAAGGGTCTTCAAGTGGATTTCTCGACTAGTCGCGAACGTTTGCAGGATATGAGGGA
ACGAGCAGGTGAAGATGAGAGACTTGACTTTTTATTCCGGTTCGAACGGGGAATTTTAACGAAGTTTTGATAATGTTGTGGATGGTGGTACCAGCTCCCC
CTAGGAAGGATGACTTCACCTTCATGGGCGTCGGACTGTCGGTGTACTCTCCGGAGTGGATGGAGGAGGGCAAACGCTTGCCTTACGTCCGGGGGATCGG
GGTCATTGCGGTCCACACAGACAACGGCGAGCTCATGAAGCTGATCGAGGAGCGTAAGCGCATCAAGCGCGAACTGCGGAAAGGTGTGGGCAATAGGGGA
GACCTGCAGGATCATGGAGACGATATCGATCAGGAGGAGGAGGATGTGGTCGAGGACAAGGGAGATGAGGACTTGTTCGACTTTGAAGATGGAGAGGCAA
CGGATGACGGCCAAGCACTCGTGGAGAGCGAGGTGGTGCGGGGTATGAAGAAGCCGCGGGGACCAGCAGTGATCCCGGCGGAGATTACCATGGCCGAGGT
CAAAGATCGAATGGTGGAGAAAGCCAAGTACTCGGCGAATGCAATGTACAAGTTCTGGGAACGCCGTCTGGACGGATTCAGTGAGCGGTATGTGGACTCG
TGTCGACGACTGACGGAGCAAATGGAGAAGCAGGCGGTAAACACGCCGCATAACGTGATGTGGCTGGTGCATCGAATTGAGGAGTACATGCGTGGCAAGG
ATGATGATGGCAACAAGTAATAACGGAGGATTACCAGTACGCCGTCCTGGCAAGCGCGTGAGACTGAGGGTACAGGAGCAACTCTGATAAACAAGAAACG
GAAGGTGCCGCGAGACAAAACAGTATGCGGAGGATTCACGCATTCTCTCAGGGTGCAATTCAAGTTGGTGTCTAGCAGATGCTAATACTAAGTATGCACT
CGCATTTCAGGAATGCGTTGCCCGTCGTGCTGAAGTCGTTGGCACTCTCAGTCATGTCCGTCTCCTGCGCTGTAGCTTGTGACCATTTTGATATGGCGAA
ATGCCTACTGGAAAGTAATGCAGCAATGAACTTACGCGATAACGTTGGCTGGGCAGCTTGTCAACGCGGTCAGAAGCGTCGGCGAATGTTCAACCTCAGC
GCCGACTCTGTTGTAGAATTGCTGTTGCTAACAGGTTTGTTCACCGCAGAAGGACACTTCAAGCTGCACGCTGCAGCA