Description :
From Genome Similarity Track
Location :
Scaffold_10:117912- 126257
Transcript NameFunction/comments
Phymu_g803protein kinase
Phymu_g804hypothetical protein PHYSODRAFT_466642
Phymu_g805hypothetical protein PHYSODRAFT_472762

Sequence
8345 bases(100 bases per row)
GCACGTGTGGCTGTGGCCTTGATGCCTGCACAGCACGCCACCTGTGAGAAACAAGGTCTCCAAACAGACTTTCGCACAGAGCATGTGCAGCGATCTTTAA
ACGTTGTAAGCGCACTGATGAGACGGCAGAGCTGCTGTTTGCGTCCTCGATGTCGGCGCCATGTTCCTGCGTGTAGGGTGTCCGTGGCGGGGACAGCTAC
AAAGTCCGTGGGCTGGACCAAAAGCAGTAGCAAACTCCTTAGTTGCACGCTCCATCTCGCCCCACTCGGTCGCGCAGCTCGCACATCGACACAAACGCCG
ACGATCTCGTATTTTCTGCAGCATGCGGTCCACAGAGGAGACAACCTTCCGTTCGATCTCAGCGTTCGTCCGCTTCGCCTGGGTATAGCTCGTGGTTGCT
GCTCAAAGGTACAAACAGCGAAACATAAGCATCGAAACTGCGCCACTGTACACTCCACAACAGGCTCTTTACCGATCCGCTGCCATCTCTTCACCTGCAC
GTACGCACTGTCCAATTCGCGCTGGATTTCTTGCTGTCGATGTCTGCTTTGATCGAGCTTCTGCCGCTGGCGCACTAAGTTGTTCTCGAGTCGGAACGAG
TGGCTCGATGTCATTCGCTGAATCTGGCACATGCGCTCCAGCTCTCTTCTCATCTCGTTCATACGCTCAGGTAgacgcgctgcagacgcagtaGTTAGTT
CATTGCGGGTTGTGCCAGACAGAGAAGCTTCGCAATTTGATGCGCCATTGTCTACTGCTCCTCCGACGGACAGATACAGTCGAACAGCGCTGTTCGGGCC
AGCTTTGCGCCTGCACACTGGACAAACATGACGGAgcgcaagagcttcctccacgCAGGAGTGATGGAAAACGTGACCGCATCGCAGAGCTGCTAAGCTT
TTCTGCAAGCTTTCGAGGCAAATAGCACAGTCACTACATGTTGCCATTTCACTGTCAGCAGCTGGGCGTGAGTTTGGACGCGCTTTTGAAGCAAAAGTCG
ACATTGGATACTGAGCTCGATACAGCGCCATTTTGAAAGTGAGCCCAAGGTTTTCGCGAGTCAAGAGACAATACCATCACTTTGATGGGAGGAGACGACA
GAAAAGAAcaagagaaagagaagaaactcTTGTGCCGCGTCCCAACACTAGTTTCAATCTTTCAAAGTGCTATTATactctttttttttcgttgGATCAT
GTACTACTATTATCTATCTGCCTATATGTGCAGCATGGCGGCGATGTAGGAAGCACTAGGACGTAGCGATGGGTCGTACTGAAGACACGCGCCTGCCAGC
TCCCGCACCATCGTGGGGCATTCCGGGGTGAAAGTAAACATCCCCATAAAACTGgtgtcgtcgttgttgtGGGCTCCCAGAACCGGGGTAGTTCGTCGTC
GGTTTTCCTCCAGAGCGAGGCTCCGAGAGCTTTGAATAATACGCGCGCCGTTGCTACTCGGCAGGCTTTCAAGCTGGGTGGTGCGCCGTCGCGAGCTGTC
CGAGTCGGGCGTGTTCGATGATACAACCGTGCCGTCGGTAGATAAAACTGTGCTGTTGTCTGAATCAAAATCGCCGATGTGAGTACGCATtctccaggag
ctcctgaTCATTTCATCCGCTGTCTGGCACGTATCCAAGTGGGCAAGCAGCACACCGAACGCGTACATGTCCGAGGACGACCGGGAAGGCTCGCCAATCA
AAATTTCAGGAGCGAAGAAAGCCTTGGTGGTGGAGTCGCAACGCTGGTAGTAGGACTGGCAACTGTAGGGTGACGAGCCATCCGTAGGGAGCGCAGCTTG
AATCGGGTTCAACTTGCAGCCCTTGGTAGGATCGACAAACACGTTTCTGCCGTTTAGTCCGTCATACGTGACCATGTGCTGGCTGTGCAGATACATGAGT
CCACGCGCGATttccgctgcagctttcatcttgaagttcttccagttgagctTAGATCCAGCACTCCGGAGATACGCTTCTAATGTGCCCAGTGTCATGT
ATTCACACACAGCAGTCATCGCGTGCCTCTCATCCCAAACGAGTCCAGTAATCGTAAGTAACTGGGGGTGGCGCATTTGAGAAAGCGTCGGGACCATATC
CAAAGCAGCTTCCACATCATCGTCACTGGGCTGAAGCTTTGTCACGAGCACCAGCTTTGTACGATGCTCAGCAAGTGCCACCACCACTGGACCAGAGGTT
GACAATTGGTTTAGCATCACCATGTCTGTGGCTGGAATTTCCTTGAAAGCAGCCTTGCGTAGTCCACCGCCAGTGTTATAATCGTTTAATGACGTCTCGA
GCTCCGTAGTCTGCACTGAGGTGCCGTTTCCTCCCATTCGCGCTCTTAGGCTTTTTAGATTGGCCTTAATTTTCCCATCGCCAGACACTAGCGAATCATG
CTGCTCCTGTGCTGCCGTTTTCTTCCATCGTCGCAGGACCAGCACACCGCCTACTACAGCCAGAACTGTAAAGAGTGTAAGGCCTAGTACAACAAAGAGC
GTAACAGAACTGGTATTGCTCTCGCTAGCTGTAGAGGATGTGCTCTCTTCTTTGGAGCCTGAGCTGTTGATGCTGCCGAGACCGTCTCCGTTTGTGTAGC
ACACGCTTTTGTCGCCCCATGATACAGCTTCGTAACCCGTAGAGCAGCTCCCGTTGACTGTCAGACTGGCTTCGAAAACAGGCAGCTCTTGTAAATACTG
GAGCTGTGGGAGCGTGACGTGGGCATCAGCGATGGCGTTGCCTTGCAGGTACAAAGCTGACAAGTTGCGCATTTCATAAATAATGGTGGGAATATCAGAC
AATTGGTTGTCGCGAAGATCTCTGTTCCGAGGAAATGGGCAAGAGTTAGACGTCATCTccagtaaaaaaaaaaagcaggAGAGACTACGTACAAAGTGGA
CACCGAAGTGAAAGCGTGTGCACCACGCGGATCAAATTGAGTGAGCTTTGACCGTTGAATGATACTGCATAAACGGAAACAAAATCAAAACATGTTAAAA
GTTTGATGCGCGGTGGAAAAACATTAAACATCAAAACTTACAGCGTCTGAAGCGAGTCTGGAAAGATGTTAGTGAGCATATCCCCGATATTAACGTCTGA
AATGACCCTGGAAAGCAGCGATAAGACTGTAAGTAAGCAAATAAACTCCCAGTAATCAAGTCACTTAACACACGTACAGGCGTTGCAGCCCTGTGCCGTT
GCGGAAGGCGTCCGAGGAAAAAGAGAGCGGGACAGTGATCTGCGAGCTTGCCGTTGCACCGACGATCGTACTGCAAATCACAACCACGCACACAACGACC
AACATCAGATGAGCTGCTACTTGTCCTAGCATCAGCTCCATCAACTTGCACGTACAGGTTTAGCAGAGTCGATGGCAGCATAAGGTCGTCGATCTCTCGG
AAGACAGCAGTGTCGGTCTTGTCGCTCTGGGGCTGGGCGATCGTAAGCGTCCACTGCGGGGTGTCCCAGCTAGCCCACGATTCGACAAGGCACTGCACCT
CGCAATGCCCCGACGTCACATTAGTCTTGCACGTCGGCATGTTAGTGGCCGAGCATCCTCGATTGAAAAACCctccgtcgctgctgtccttGCTCCTGGC
TTCCTCAGTTGACGGCGCGTAGTTCACACACAGAGACGAGCTACACGCCCCATAGCAATTGCTAGTGAGTGTGTTATGCTCCGGTGGACTGCACTCGCTG
TCCGCAGCGTTCACACTGGCAACGATCATTGCCACAACCGCCACAAGACTCCGAACGGTGCGCACTTcacgagttcctgctgctAAGTTCGCTATAATAA
TCTCTGCGCCGCGCTGTACTCCAAAACCACGCTGCATTGGGGCCCTTGTGCCTCTAGAACCTAGGTTAGCAACgcagagagagagaaatCTCAGTCAGAC
ATTaagcaagtggagaagcgacTGTTACTGGCCTCCTACCGACGTGATTCGCGTGATATTTCGCGCTGGTCACGAGCGAGAGTAGCAGTACACAGTGGGT
GGAACTTGCTCCTCGACGCGAAGGCTTTGAGGTGCAGGGGCTCACACGTATCCGCTCGGACGGCGAGCGGGTAATGGAGCGGCACTGCCTTGTGTCGGTC
CACGACCGAATGTCACAAGTGCGGCGGGGCAGCTTATGTGCATAAACAGGGTGTAAAGCCAGTTGAAAAACCCTGATAACAAATTCGTTTCGCTTTAAAC
ATTTGACTTGTGCTCACTATGGTTTGAAAACGCTGGTCGTTATTTACTACAGTATGGGTGCAACCAGTTTTGAGCTTCAGGTTGGGGCTTGCTCGAAAGA
CATACGAAGCTGCGTGGGGAATGGTTGCTCGATTGAAGCTTTGTCACTCGTGGAGATCGTTCCGAGTAGAATCCATCCGTTTCGtgccgttgaagctcgt
GATGATGACCTCGTTACCTCGAGCAGCGCTATTGTAGTAAGCGTGTGTGGTGGTGATGGAAAAGTATTAATAATTGCAGTCGAAAAGACTTCTGTTTCCC
CAGCAAGCTTGCTGTATGCTTCAATACATTCTTGCAGGACTATTTTCGCCACAATTCTCGCTGCGGACTGTCAAACAATCAACATTTGGGCGGGCACGAC
CACTGTGACGGCCACACAGCTGACATCCATCGTGCGGCTCGGAGGAAGGGTTTCGTGTGAGCGACGTGGCTGTCCGGCGCTGCACTTTCAGTAGCTGCTT
GAATGACGACCTTCAAGGGGCCACTTCGAAATTGACGATATCTGTGCACTGCACTGCACTTCGCTGAATTGGCTGGATAGGCCTGCGTCTTTACGATCAC
GACGCACTCAGCTAAAGTGCTGGACATGGTAGTACAGAGTAAGTCACATGATATTAGGACTCAATTTCCTAAATTAGGTAGAATTCTAATTTCGGACTGA
TTCTATTTTCATGAAACAGTTGCTGCACAGCAACAATCTTTGACTCTAAAGATGGCTACGCTATTTTCTACTGCTGCAAACAGGTGATGCCCCTCTCTCG
CTGTCCGTCTCGAGAGTACCACGTAGTGAGTGCCACCAGCCAGTGGTGTCAACGTTTTGCAACATGAGCGCACGACGACTGCGTGAAGCAACTAAGACAA
CGCCTAGGAGCATCCCCAGTGCGTCTTTATTCATACGCATCGTACAGTACCCATACCTTTCGCCGGGACTTACAAGTGTTTTGCTGTACAGATGCACCGC
ACAAGGCAGCGGAGAGTGAGCATGAATACCTTCGGCAATGTGTCGACCCCGTCCTGATGCCGCTGATCGAGTCGCTGCTCCTCTACCAGCCCGAAAGTGT
CTACCACTTCATCCATGATTTCGTGGATGAACAAAAGGCCAATCGCTTTGCACACCACACGAGGAGCGTTGGCTACGCTAAAAAGCTTACTAACCGCCGC
AAGATGGCGGACTTCATGTCCACTAGCGTGATCCCCGTCATGGACGACCTGGCCAAACAAATTCTACGCGAAAAACCCAATTCCGTCAAAGGTGAGACTT
GAAGACGGTGTAGAATTTACGTAAATTCTAACTGTGTTTTGTTCCAAAGCTTTTATCAGAGATGTGGTTGCAGCGCGTATCGTTATCGACTCTGACGAAG
CATCAAACCAACGCGAAGCTGAAGTTCAATTCAGCGTCAACGATCGCGTTCTTTGTCGCTATAAAGGCCGGCCTAGATTCTTTCCGGGCGTCATCACCGA
TATCGACGACAACGGCAGTTTTAGCGTCTTGTACGATGATGGGAAGACAGAGGGCAATGTCCATCTCATGTGTCTAAAGCTACATCCTACACAAGAAACC
AGTGGTAAAGCAGCCACACAAAACGGAGAGCCTGGAAATAATCAGGAAAAAGCCAAGATCACTCGCAAAATGGCTATTGTGCTTTTGATAATTGGAATCG
ACGGAGCAGGGAAGACCACACTTCTATCCACGTTGCAAGGCGATCTGGACAAAGAACACGTTCCGAGTGCAGGCTTCACATCAGCCACGTTCGAGACTGA
AACAGGATCCGCAACATTTTACGATCTGGGAGGAGGTCCAACATTTCGCAACGTGTGGAAGGAGTACTACGCCGACGTAAGTGCTTCCATTTGCTGCACA
ACTGCATCGGTACTGATAGCTGAACGTTTGAACGTGTACAGGCCCATGGTGTTATCTTCGTGGTTGATTCCTCAAGTGAGAATGCGGTGCTTCAGGCTGC
AAATGTACTTGAGGAATCGATGGAAAACGAACTGATGACCAACAAGCCGCTGCTAATGTACGTACAAACTTAAGATCTCGTACTTGAAATCACACTTTGA
CGAACTTGTGAGAACTGTACAGCTTCGCCAACAAACGAGACCATTCCGACGCGGTACAAGAGCATGAGATGCAGAACTTGCTGCGTTTAAACAAGTTCCC
AAGCTCCAAAATCGCCCCCTGCGTTGCCAAACCAGCAGTTTACGGTGGTGTTGTCGATgaacgtcttgaagctggcCTGCAGTGGCTTTTTGATCAAGTC
CACAACGACTTCGACACACTTCAAGAACGTGTCCAGCGGGATCTTTCCCTTAAAAAGAAGCTTGACCAGGAGAGACGGGAGCAACAACGTGCTCGGGTCT
CGCGATGGAAAGAAGAGCGCGAACTCACCCAAATGAGTACGCACGACAAGCCTTCAGCGGAGGATCAGGGTTCATCGTTAAAATCTGCCGCTGATAGACC
GGAAGAAGCCGTCATACAGTGTTCGGAGTGCAGAACAGCCCCAGCAGTAACCAAGTGTGCGGCGTCTAAATGGATGCCTGTATGCGAGAACTGTGCAGCA
ACGCTAAGAAGTCAGTCTGCATGACCATGTAATTCAATAATGCTTCAGCAAACCTCAATTGCGTCTATAGGAATCCTGACAGCGTCTATCTCCGCTTCTT
TCCTTTCTTGCCACGACCacgttgctcttcttcttcttcctttttcTCTTTCTTAGAACGCGCTCCGCTGACGATTTTCTCTACGTTCTCCTTTTTCTTG
TTCTTACGCATCTCCTTGCGCTCCCTGCGTTTTTCAGcagccttctgctccttTTCAAGCCGCACACGATCAGCTTCAGCCTTTTGAAGTACAGCCTCCT
CGTCAACTTCTTGTTGCTCAGTATCAacatcctcttcatctgctaTCTTGGCAGGTGCTTCCTTTGTAGCCTCAACCTTAACCTTGCCAAGTGCGATAAG
CTCTTCCTGGAGGGCTTTATCCATCTCGTCATCCAAAATGCTGAGGTCGCTAAACACACcgagctcctcctctttctcgcGGTGTTTTTTCGAAGTGAGG
TGGTTCCGCAACTGCTTCGTGGACTTGAATGTCTTGCTGCATAAGTCGCACACAAGCACGTCCGCATCCATTTTCTTTCGGAGCTTCTCAAGTTCTTGCT
CAATATCTCTGTCGGCAACTCGACTGGTCTCCAAATTGCTGTCAGCCCAAAGCTTTTCCTGTTGTTCTTGAAAAGCACGTTTTTCAGCGTCATATGCGGC
TTGCTTTTCACGtttcttggcctcttcctcgacgcgTCTCTGCTCCTTTTCCTGCTCCTTTTGCTTCTGGAAGGCTCGTACACGTGGGTCGCGACGATAC
ACGAACTCCACGAGTTCGCGTACCTCCGTAGTAaacgccttcttggccgcatcacgcagcttcttgttctctttTTCCATTGCTCGCCTTACCAATCTCG
TCGGTGCATCCGTCGTCTTGTACTCATCCACCCACGCAAAGCTTCGCCGCGATGTGTagctcttccagtgctgATAGAAGTAGTTGACATCATCCATCGA
AGTGTTGGCATCTCCAAGCTCTGGTGCAACTCCAGCATTCGAACCATCGCCACCATCCAGATCCAGTCCATCGATCTGTCTCACACAAATGACCATTAGC
ACAATAAATCAAACAGTAACTTGTTTGACAGCCAACTAACCTTGGTGAAGAGCTCTCCATACACAACGTAGAAGCTCTTTTCGTCCGAGCCGAAGCCGGA
ATACACCGCTGCGCTGAAGTACCGGAACAAATTgagctcgtcctcatcctcttcgtcgccgtTCCCATCTCCGCCGCGCAGAATCTGCTCGCGGTGCTCG
TCGTACCATTTCTTCTCGTGCGGGTCACTCAGCACCTCGTAGGCGTTTTGAATGGTCTGGAACTGCTCCGTGGCCTCCTCGCTCGAGATCCCGTTCTTCT
GATGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGTCGAaaggccttcttgatctcgacCGCCGACGCGTCCCGCGCAacagccagcacttcgtaGTGGCA
GCGCATTTCGCCCAGCGAAAATGTGTAAAAGTGACGATGTAAAAA