Description :
From Genome Similarity Track
Location :
contig_31:117908- 119786
Transcript NameFunction/comments
g7121.t1RAW27207.1 hypothetical protein PC110_g16392 [Phytophthora cactorum
g7122.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
TGGAACGCCACCGAAGTTGAAGGTCACGAAGGCCTTCTTCCTGTCCTGTTTGCTCACCCAAAACTCGGCCAGCTTGGCAGATGTTCGGGATGCAAAGTCT
ACCTTGGTAGGGTGCACACTCATATCCGGGAACCCGTGGAGATACACCATGACTTCGTCGTAACTCTCAGCAGCCTCCTTGCTGACGTCATCCGGCGTGG
CTAGAATCGCCAGCAAGTTCCTGCTCACCCCCGTTGCAGTCTCAGTCGCTGGCACCTTCACTATGACATGACGAAGCTGCATGGCATCAGTATCTTTATT
TTTCTACAAGCCCAACACTATTGGAAATGAAACACTGCCGTCGCGTGACTTGTTTTTTGTATGTTGAAAATTTGAAATTTGTTATTCCTTTGGTAACTAG
GGTAAGTTACACAAAATTGTATTTTCAGAATTGAACACGAATATGCCTCCAGTGCCGCCTGGACGCCGGGGAGACAAGGGCGCTGCGGCGTCCACGGGGC
CCGACGACAACGTGCCGTGCAACTACTGCGTGGGCATCAGCATATACACCAGGTAGACGCTTCTCCGGTCCAAATGCGCCCTCGGGTTATGCCAAAATAG
GTACTAAATCATAATATGGTGGAATTATTTAGAGCCATGTGGAAAGAACGTCAAAGCCCTGAATGCAAGGGTCTTCAAGTGGATTTCTCGACTAGTCGCG
AACGTTTGCAGGATATGAGGGAACGAGCAGGTGAAGATGAGAGACTTGACTTTTTATTCCGGTTCGAACGGGGAATTTTAACGAAGTTTTGATAATGTTG
TGGATGGTGGTACCAGCTCCCCCTAGGAAGGATGACTTCACCTTCATGGGCGTCGGACTGTCGGTGTACTCTCCGGAGTGGATGGAGGAGGGCAAACGCT
TGCCTTACGTCCGGGGGATCGGGGTCATTGCGGTCCACACAGACAACGGCGAGCTCATGAAGCTGATCGAGGAGCGTAAGCGCATCAAGCGCGAACTGCG
GAAAGGTGTGGGCAATAGGGGAGACCTGCAGGATCATGGAGACGATATCGATCAGGAGGAGGAGGATGTGGTCGAGGACAAGGGAGATGAGGACTTGTTC
GACTTTGAAGATGGAGAGGCAACGGATGACGGCCAAGCACTCGTGGAGAGCGAGGTGGTGCGGGGTATGAAGAAGCCGCGGGGACCAGCAGTGATCCCGG
CGGAGATTACCATGGCCGAGGTCAAAGATCGAATGGTGGAGAAAGCCAAGTACTCGGCGAATGCAATGTACAAGTTCTGGGAACGCCGTCTGGACGGATT
CAGTGAGCGGTATGTGGACTCGTGTCGACGACTGACGGAGCAAATGGAGAAGCAGGCGGTAAACACGCCGCATAACGTGATGTGGCTGGTGCATCGAATT
GAGGAGTACATGCGTGGCAAGGATGATGATGGCAACAAGTAATAACGGAGGATTACCAGTACGCCGTCCTGGCAAGCGCGTGAGACTGAGGGTACAGGAG
CAACTCTGATAAACAAGAAACGGAAGGTGCCGCGAGACAAAACAGTATGCGGAGGATTCACGCATTCTCTCAGGGTGCAATTCAAGTTGGTGTCTAGCAG
ATGCTAATACTAAGTATGCACTCGCATTTCAGGAATGCGTTGCCCGTCGTGCTGAAGTCGTTGGCACTCTCAGTCATGTCCGTCTCCTGCGCTGTAGCTT
GTGACCATTTTGATATGGCGAAATGCCTACTGGAAAGTAATGCAGCAATGAACTTACGCGATAACGTTGGCTGGGCAGCTTGTCAACGCGGTCAGAAGCG
TCGGCGAATGTTCAACCTCAGCGCCGACTCTGTTGTAGAATTGCTGTTGCTAACAGGTTTGTTCACCGCAGAAGGACA