Description :
From Genome Similarity Track
Location :
Scaffold_282:1179- 5041
Sequence
3862 bases(100 bases per row)
GGTCGCTCGACGGCAGGTACTGGAGGTCCCGTTGGTGCCTCCTGGTCCATCTGCTACGTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAG
ATCCGATCGACACATATCCTGGGATCCGGGGTATCCGATCTCCGGCCAGCCACATCCCGATCCGTTCATTTCGATGCAAGACAAGATCTTTGTCACTGAT
GTTGGTAATCTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGGTTGGCACCCAGCGATCTCCTCGGGTGACCCATAGCTTTTCTCGATCCGTCACC
TTCATTCGCAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCATTCCCTGATCCACACACACGTGTCGGCCATTGTCGTTATACAGTTGACGCCGTC
CGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATGGAGCCGTCCGCAAGATCGAGGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGC
CTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCAGCGATCCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACG
CTTTCGCCAATCCCCACACATTCCTGGCTCTGACTCGTGTCGACATAGCACCCCACCTTACGAGCAAAAGCGGTGTCCACGATGGACACCTCGGCGCCGG
TGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCAGTGATCTTGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGA
CTCTCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCACTGACGCGAGGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTC
ACTTCTCCATCAGCTGGCGTAAACCATTCTTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAAGGCACTTCGGCGTCAG
AACGGCTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTAC
TCGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCT
TCTCGGCGATCGCGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTG
TAGTTCACCACATCCACGGCACACAAACAGGCAGCGATCCGCCGGATGACCTCTCTTGCCGCACTTCTCGCACGTCAAACGTCTCCAACAATCGAGATCG
GTGTGTTTCCGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGA
TCTGCGCCTGGTTGATTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTACGGGACTTGTCCTCGGTCGACGCTAGGTAAACGCGACGTAGATCACCCTC
CGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGACTCCTGGCTCGCGATCTGCGCTGCACGCACTGCCCGCTTGGTTGCAGCAGCTGGTGCTGAGGTC
GGAACCTTCTGACGATACTTCGATCCAAAGGCGGATCGCTTCTGTCTGCTCATCGCGCGCTCTCGAGCGCGTAGGACTTCCTCCAGATCTTCTGCGTCCG
CAAGCCGGAGTACGATCGGCCAGTTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCTCCGTCCTTGATCTTCA
ATCTCGCACGCAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCATCTGATCTCTTGCGAGAATGGTAATACTGCCAAGCGACCGATAC
TCCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGATCGCTCCACTTGATCCGCGTCGATCGGCCCAGCTGGTGGTACCAGTTCTTCGCCGGGCCC
GTCAGTAGATCAGCAAAGGTCAGGCACTTCTCTTCGTCCGTAGTCTGATTTCGCAGGAACGCCGACTTTACCTTGCTGATCCACGATCGGCCGCGGTCTT
CGTCCTGATCCTTGCCATTGAACTCCTTAAGATCGGACATCGCCGAAATCCGCCCACGCTGGATCAATGAGGACCCAGTGGATCCTGAGGCAGCGGTGGC
CACCGCAGCAGGGGCTGAACTCGGTAGATCAATGTCGTCCGGATTGTATTCCTACTGAGAGAGATCTTGATCCAGCGATCCGGCTGATTCCATCTCCACG
TCCCGCGAAGACTCCAGTTTGCCAGTCGACTCATCTGATCCGGTAGTACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCA
TGCGTTCCTGACGTTGACTCCGTCATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTA
TTCCGCTGCGGAGACATAAGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGG
TCCGGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTGTCTGGATCACATCGAGATCCTGATCGAAAAGATCAT
TCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGCCACTCGGGGGGCCGAGAT
CGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCC
AGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCCTCACAATCTGGTCCTTGTCCGCGA
TCGCGTCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCTGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGC
ACCAAGATCCACCGGGGTCCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTC
CTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTT
GCGCATCTTCTACGGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGA
TCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCG
GGCTGGATATGCTCTCTCGGGACTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTC
TTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGT
TCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA