Description :
From Genome Similarity Track
Location :
Scaffold_542:1179- 3881
Sequence
2702 bases(100 bases per row)
TGGCAATTATGTCAAAGTACGACGTTGTTGTTCTCGCCGCACTAGTACCCGAAGAATTAAGCATTGTTAGAAATTACACTCATTTTCTCACCGTAAGATG
GTGCAAAGAGCTTGTTAGAAATTACACTCATTTTCTCACCGTAAGATGGTGCAAAGAGCTTAGCACCTCGCATAATTCAACGCTTTTCACCGTCCCTCTT
CTGTGTCTGCTCCTCAATTCGCAACGAAAGGTGTCTGCCATTTCGCTTATAATTGTTTCGACAGCACATCATAGACGTTACGTCCGCACGAGTGAGACCG
AGATTTCTGACGTGAGAACTCCCTCTTCGCATTGCTCAAGTTGTTTTGCCAGCGACTTTGTAGACAGACAGGAACATACGTATGCAGGCACCACCGTTCC
CATAGCAACAGTAGATATGACCCACAACGCTGCTCATGGATGTGGAAGGCTCTGTGCTGCGTCCGAGCTGGCTGGCATTTAGAACTCTGAGTGGCTGCAA
ACAGCTTGGCAAGGCAAGCCGTAACACAACTCGCAGATGGACTTGTTTGCAACTTATGCTTGTTCAACTTGATGCGTCCGACAACTATTCGCATCGACGA
AAGTAGCAGGCACGTCTCCAAACATCCAGCCAGTGCCACGTAGGAGGTATACACGAACCGAGACTGCACTCTCACGTCCGTCGAACTTCGACGTCACTCT
TCGTACCTTCACCCGCCATCTTCCACGCATCGAACATACTTAGAGTCCGTGCCACCTTTGCAAACTTCAAACCTGGGACCGGGTCAACTGCTAATACTTG
TCCTGGTTCAGTGTCGCGAACAAGCACCGTGCAAACGTTTTGAACCGAAGTTACCACAAAAGCGCTTTGCGCGCAGTCGTCACTTACGTTCCGCACGACT
ACACAACGCCTGAAGCAGTCGCACGTAGAGCGCGCTACCAGTAAGACCGACTGGTTATACCACAGGGCCCTGGGATCACGCTCAATGCGACAACAACCTT
CCACACTGCTGGGCTAGGTCTCGGCGGCTTCAACTGACAGGCACAAGCAGCAGTGCTGCGCCTCAGGCTGGACTTGATCACCAACTCGCGCAAAAGCTCG
ACGTTTTAGCTGTCCGCGAAGCATAAAACAACAGGAACCCATGACCGACGAAGATGCAGCAGTCTCGCATGTCCACTGCTGAAAGTAATGCCAACCCGTT
ACCGCAAATTTGACGTGGCGCCAAAATGTGATGGCTGACCCCATCTCCAGCATTGGTGACGTATCACACGATGACAACCAACCTTTCACTTCAAGTCGTC
AAAAGTAGGAGAAGTCGACTTCACAGGCCTCGTGTCAACCCATCAGCTAGTCAACTACCGAAACACTCCAGCGTCAACGTACCAGGTAAGAACATCGACA
GGAAAAAATATGAGCAGATGAAGCCTTTCGTGACGATGAATGTAAGCTTGCTGCAATCATATCAGCGGCAAGCCTTGCCTCGGGCTGTTCAGCCTGCGTC
GAGCTCGACCACTCAAGCGTACAAATGGTAGCTGGACCGACTGGCACAAGAAGCGAGAGATGAGTCAGCCAGGAGCAGACATTTCCAAGTGCGGGTACCC
AGTCTTTAAAATAGCATTTCGGACTCCATTGCATCATCTTTCATCGCTCCGCCCGCACAGGCAAAGCTTGCACAAGTTGACCCGTCCCGGTTCTCAACTT
GTCCTTTCATAGCAAGCTGTGCTAATCTGAGTTCACGGCCGAAGAACACCGTGACGGGCAGCTCCAAAACCACTACCGTCGACGATGGAGCTTACTTGCC
GATTGCAAATCATAAAGCCTGACGCCAAGTCTTCGTGACCCAAACGTGCCACAGCCGAAGACGGTAGCGGCAAGCAGCAAAGACATGTGAACAGTGATTG
CCCTTCCTACTCTCCGATGCGGAGGACCTCGTAGCTGTAGCTACTCGCCGGTATCACGCGTAGAAACTCGGCAATCGGCCATTGACTGTGGATTTCGCTG
ACGCTTCCCTTGAAGCACATCATCGTCTTCGTGCACGACAACACCTGATAAGCCCTTCGCCGTCCACGAAACATCTACGTGGAGATACAAAAGGCACGTC
GCACGAGGCTTGTGTAGCCGTAGCAAGGGTCACAATGAAGGCAGAAACCGCCATTTTNNNNNNNNNNCGGATGTTGGTCAAGACATCAGCTCTCGTATAG
AGCCTACTACTACTACTAGTAACCACGGGGACACTATTGTCCCGATCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGATGCCATGTGGCAAC
TGTTAAGCGCCAGGCGTCCGAGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTAACTTGCCAGGTTGAGGGCAATGTTAGC
CTGTAAACCCTTCCATATTTGGATGCTCTTTGTGAGCTAGACGAAGTGTCTGATGGCGAGTTTTGTCAGGCCTTGAAGACAGGAGATTTATCCGAATTAG
TGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGACACTCAGTGCCCGGAGTGGATCTTC
GATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCACAATCCACCATCTGTCTTACCTCCCGGTAGAGTT
GT