Description :
From Genome Similarity Track
Location :
Scaffold_2632:1179- 3035
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2632-fgenesh-gene-0.0Protein kinase

Sequence
1856 bases(100 bases per row)
TTCGGGCGCTCGAGTCCAGAGAGGCTTCACAGCGCAGTTCCAAAGATAATGCATCAGACACACTAGCAGTACTACGCTCCTGCTCGGCCTCGTACTTTGC
CAAGCGCACGGCTGGGATGGTGCTTGAACTGTATTCCAGCACGAGGCTTGGTCAGCTGGTCGTTGACGTGAATTACACGAGAGGCCGAGGGCGATCTCAG
CCTGTTGCAAAGCATGCGTGCGCTTGTGTATGACTTCATTGGGAATTACGGGGTTCGATACGCTATTGCTATGCGTTGTGTTTGGGATCTTATAAGGACA
TGGAGACCTTGGACTGGAGCATGTAGGCGATCTGCATGGCGTTCGGGCGCTTGTCTGGGTCCTGGCTCAGGCAAGCCTCGGCGAGCGCGAGCACGGCCGG
CGGGCAGTCCGGGCGGAAGCGCGGTGCGATCTTCCCGTTGCGGATGAGCGGCAGCAGGTCCATGCTCTTGGTTCGCGGTCGGCCAACGTCGTCGTTGAGG
CTGTAGGGCGGCAAGCACGTATCGAGCTCCGAGAGCACGATGCCGTACGAGTAGATGTCGGCCTTCTCCGAGTACCGATCACCTCGCAGGACCTCAGGCG
CGGTCCAGAGAAGCGTACCGACGCCCATGGTCATGGTCTCTTCAAAAGACCGCTCGCGACTCAATCCAAAGTCGCTCAGCTTGGCCTCGAACGTGGCCGT
GAGCAGGATGTTGAGCGACTTGAGGTCGCGGTGGATGATCACGGGCACGAGCGAGTGGAGGTACACGAGAGCCTTGGCGATGTCGGCCGCGAGCGAGAGC
TTCTCGTGCTTCCACGTGAGCGCGCGGCTCTCAGTCGAGACGAGGAAGCGCGCGAGGTCGCCCATGGGCAGGAACTCGGACACCATGCTGAGCTCGGCGA
GCGAGCGCCACGAGAGCCCGATGAAGCGCACGATGTTGGGGTGCTCGAGCGACGAGCCGAGCCGGATCTCGCGCGAGAAGATCTCGATCGCGCGCACGTC
ACTGCGGATGTCGGTGAGCAGCCGCTTGATCGCGACGAACTGGCCCGCGTACTCGCCGCGCCAGACTTCGCCGTTTGCTCCTTTCGCGATGAGCTTCTCA
AACTTGAGCGTCTCGTAGTCGATCTTGCGCACGAGGAGCTCCTCATCGTCGCAGAAGGCCACAAGTTCAGCGGAGCTGTTGAGGTACTCCTCGTTCGCCT
TGTCGACCGCAAAGAGCTGTGAGCTGCGCGTCTGGGGCTCCGAGAGCGTCGAGACTGGCCCCGGTGTCGGCACAAAGTTGCTGTACGTGTGGTTGAGCAC
GGCGTAGGGCGGCGACGGTTTGCGCAGGCGCTTGCGCCAGAAGAGCAGCGCGAAGGAGCCGCTCACGAGGCACATGATGCCGAAGAGCGCGATGAAGATC
GTCGATGTCTGCACCCACTTGCTGTGGTCAGCCGTCGTGAGCTTCGTGGTGACCTCCTGGGTCACCCAGAGCTGTACGAGCGAGCCCGCGGTCGGTTGGC
ACCAGCTGCTGCCCTCGATCGAGTCTGGAACGTTGCCCTTGGGTCGACAGGGCACGACGAAGGCCTCGGCCATGTTGGGACACGTGTTGTCGTTCAGCAG
CTGGAAGACCGGATTCTGGTAGATCGTGTACAGCACCGTGCTCTTGTTCACCGAGCTGCTGTTGACCGCGCTCACGGACGTGTCGTACTGGAAGAGCTTG
AAGTTGTACTCGTTCGCTGCGGCACCCTCCTCCGACCAGAGCGAGCTGCTGGGCTTGACCGCGATGCTGCCGGCGGCGTCGGCGGCGTCGATCGCGCAGC
GCGTCATGGGCACGACGCTGTCGGCCGAGCAGTTGGGGAACGCGAACGCCAGGATC