Description :
From Genome Similarity Track
Location :
Scaffold_1551:1179- 2212
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1551-snap-gene-0.3TRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
1033 bases(100 bases per row)
CGCACGCGGCACCAGATTTGGCTCGAGCCCGAAGGTCTGAACAACTCGATTGTGTACCCAAACGGCATCAGTACGGCACTCCCGGCAGATCTCCAGGTGC
AGCTACTGCGAAGCATCCAAGGGCTCGAGAATGTTGACCTCGTGCGTCCTGGCTATTCTGTCGAGTACGACTACGTGGACCCGCGATCGCTGATGCCGAC
GCTGGAAACGAAAAAGATTTCAGGATTGTACCTCGCGGGTCAGATCAACGGGACGACCGGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGCC
GCGGCGCAGGGGATCGTTGCGGGCATCAACGCTGGTCTGGCGGCACTGGGAAAGCCGTCGTTCGTGCTTGATCGCGCCGACGCGTTCATCGGCGTGCTAA
TTGACGACCTCGTCTCGCTCGGCACGAACGAACCGTACCGCATGTTCACGTCGCGGTCCGAGTACCGTTTGCTGCTGCGGCAAGACAACGCCGATTTGCG
TCTCACTCGACGTGCTTTCGAGCACGAAGCGGGCATCCCCGAAGAGCGCATGACGAAACTCGAACGCAAAGAAACCGCGATGGCGTATGCGCGTGATGCA
CTCGAAGGATTTTCGTGCGATCCGCACCAGTGGAACAAGTACGGCGTCAAAGTCGGACTCGATGGTGTCAAGCGCACTGCGGCGCAGATCCTCTCGTTTG
CGTATGTGACGCCGCGGGACATTGAGACGATCTGGCACGAGACGCAATACGAGAAAGCCGACGCGCTGCGTGACGACGATATCAAGGAGCTGATCAAGAT
CGAGTGTCTGTACGCGACGCAGTTGCGGCTCCAAAAGCAGGAGATCGACGCATTCCGCAAGAAGCAGCACATCGAGATTCCGTCGTGGATCGACTACGCG
ACGCTGCCGATGATCTCGAACGAGGAGAAGGAGAAGCTGAGTCAAGCCAAGCCCACGACGATCTATGCTGCAAGCCGCATCGCAGGCATCCGATCCGCGA
CGCTCCTGCTGCTGTACCAGTACGCGATGCGCA