Description :
From Genome Similarity Track
Location :
Scaffold_3:1178037- 1179624
Transcript NameFunction/comments
Physo_314342Hypothetical protein

Sequence
1587 bases(100 bases per row)
GTGCAGCACGATTCCACAATCCAGTGAAAGCAAACTGCTCTCTAACCGTACTTGTCACTGTTATAGAGCTTTTCGACATAAGAGGCACTTCTCAAAAGCT
CAGTTTCAGTGTCAATATGCAGCTGTTGCGTCTCGTTGCCATCGCTTCGAGTGCTGCGGCCGCGCTGGTGCTCGCCGAGCCGCTCAAGGGCAAGATCCAC
CTGGCTGTGACCGACTCGCAGCCGCCCGTGGCCCAGCCCAACGTCAAGTACTACGCCCACGTGGTGGCGGACGGCGACGAGTGCGACTATCCGGACATGA
CCATGCCCATGTGCGCCAACAAGGACTTCGTGTGCAGGATGGAGCCCGGCCAGGAGATGTTCGCCACGGCGCCCTCGTGTCTGGCCTACGACCCGAGTAA
CATGCAGGACAACCCGTTCGAGATCGAGGAGACGGCCGTGGCGCCCTGGGGCAACTGCGACCCCGTGGCCGAGATGAACCGCAAGATGGGCGACCCGCCA
GTGTGCAAGCGGGAGTTCCAGTGTCTGTGTCTCCATGGAGCTGGCCAGAACTGCGTCTGCGCCCCGGCAGATGCGGTGGAAGATGCTAGCGGAGCTACGA
AGTGCGGCAACGCGACGACGACGTGCACCGAGGACAAGTATTGCCACTACCTCCAGGAAGGGGGTATGGAGTGTGGACAGAAGCCTTACTTCTCGTGATG
AGGTGGAGAGATCGATCGCCTGCTTTGCATTTCTCGCATGAAACAACCATTAGGATGTTCCTAATATACAACACAATTTCGTACGTACATGATCAGTTTG
ATTTGGCTTGGGGAGCATTTATTGTTGCTTGCACTCCGAGGGCCTCTCTGACTGCTCGTCATTAGAGGACATGTTTCTCGTGATGAATCGTGACAGTCGG
CGCTTTGACCGCCGTTCCCATGAAGAGGGAACTGAGCTGAATGCAGTTTGAGGAGCTGGAGACCTGGACGAGAAGAAATCTTTCGCGTCTGCGAAGTCAG
GGTCTGCTGCTGCAGATGCAGCACTGCTGGATGGCTGTACAGTTTCGGCAGTCGTGAAGTCATCCTCCAATCTACGCTTCCTTCGTCCGGCTGATTTAGA
AGTGGGTTTGCTGCTTGCGCGGGGTCCATTTACTGGAGTGGAGTATTCGCTTTCCTTCGGGGTTAGTGTCGAAGCAACAGGACGCGACTCATATTGTGCC
TTGCTCTCAATCTGTTCCTGGCTGGACTTGGTGTTTTCTTCTTCATGCTGTAGCTCTGCTTCGGGCATATTTGAGGGCGAGTTTTTTCCTGCCGACGCCG
GAGCTCTCTCAACGTGGGATGAAGATGTTTCGTCTTCCAGATGCAGATCTGATGGTTCCTCCTTTTTTTTCTTGCGCCTCTCTTCGTGCAATCGCCAGTG
ATTCACGGACTCCTGGAGATCATGTACCTCATTCACTAGGCTCATGTTTTTGACGTGGAGCTGCTTTTGCTCCTGGATAACCTTGGCATTCACGAGAAGC
AGCTCGCGACGCTTTTGATCGATCTGCTGCTTGTCATGCTCCAGCTGCTGGATCCGAGTCAAATAGGCGTTCTTCATCTTTTGTGCC