Description :
From Genome Similarity Track
Location :
contig_7:117793- 122808
Transcript NameFunction/comments
g2478.t1OWZ18382.1 Dynein heavy chain [Phytophthora megakarya

Sequence
5015 bases(100 bases per row)
TCGTCAGCCGCTACATTCTTCGACGCCAGTACTCGAGTTCTCCCATAGGACCGTCGTCATCAATCGTCTGGTCATTGTTCCCTTCGCCGTCATTCGTCGT
GTTTGTCTCCAAGTAGGTCGAGATGACGTCGCACCACTCCTTCAGCACGTCTTCGTAGTGTGCGATCAACTTGGGCGGGTCGGAAGCCTGCAACGCCCTC
GTACCATTGACCGCATGACCTGCACTGCTCACGGTCTCCGCAAGGATACTGCGGTCGGGTCTTCTCAGCTCCAGGCCACTGTCCATACTATTGAGCGCCT
CCTTGAGGTCGTTGGCGAACTTCTCAGACTCCGTCATGAACTCGTTCTTCAGATCGGAATCTGCTATCCCCCACTCGTCCTTCACCTTCTACAGAACGAG
TACATTGACGTCTTCGCAGTGCTGAGCCGAAGGACGAAAAGCGTCAGTGACGACACGAAGCGGCGCATCCAGACTCTGCTTCGGCGGTGGAAGCAGATTG
ACATCGGCATCACAGAGGCAGCCAACGAAGCCAAAGACAACGTCAAGTACCTGTTCACGCTCGAGAAGTTCATCATCCCGCTGTACAACGGCACACCCAG
CTCCATCATCGATACGCTCCCGGCGCTGATGAACTCGATCAAGATGATCCACTCCATCGCGAGATACTACAATACTACCGAGCGGATGGCCAACTTGTTC
ACGAAGATCACCAACCAAATGATCACCAATTGCAAGCACTGTGTGACGGGGGGGGGGGGAGACCTACGAAGTCATGTGGGACAAAGACCCGGAAGAGCTC
GTGCGGCACCTGGACTCGTGTCTCAAGTTGAACGAAGCCTACCAGCAGCAGTATCGTGTCACCAAAGACAAGCTATTTGCAACACCCAAGGGCAAGCAGT
TCGAGTTCAACGAGATGAAGATCTTTGGGAAGTTCAACCTCTTCTGTCGGCGTGTTATGAAGCTGATCGACATGTTCACAACGATTCCACCAGTTCTCGT
CGCTGGTTAATAGTGGTGGGTAATCTCTCTATCACGGAAAATAACGTTATTGGGGTTAAAAAGATATTTTTAGCGTTACTTTAATACTGTATGATATTTG
CAATATCATGAACATGTTTGGCTATATTTGTGTTTTTGGCATTGTAAATTACTCAGCCCGCCAAAGTCATCTTGTGGCACATTCGCCGACTGCTCTGAGC
TTCTTTCTGGCGGTACGCTGTCGCCTCTGTCCGGCGGTTGATCTGCGTCCGGTGCCCGAGCCGGAGGTGGTCACAGGTTCTAAAGCTGAAGACTAGTCAT
TGTGTACAACGAGATGACCGACCTGGTACGGCATCTGCCACGCCGGGACGATCCCCAGTGCGCAGTGACGCCCAACGGCGCGACATCCCAGCCCATGGAC
GTCACGGCTCTGCTGTCGGCGGCACCGTCTCGATCAACTCGTACGGCCGTCACTTGAGTGACTCGTACCGTGACCTGAACCCTGCTTACTTCCACATCGC
CGCTGTGATCCTGCTGGGCAGCCTGAATTCGATCTTCATCGTTGATGTCACGGCCGGTTCGGAGGTTTTAAGATGTGCCGTGTTCCTAGAAGAGGATGCC
CAGACGGCTTGGAGGAACAACCGTAGAGCTCGGCTGCTAAGAGCACCATGTACGCCAAGACTCGTCGTCTCTCGTGGATTTTCGAGACGTACACTGATGG
ACCTCTGGTGCCTTCGGGCTCGTACACGACGGGTGCTTATTACTACTACCTGCTTGAGATGGACGACGCTGGAGCCATCATTGATGGTGAGTGGGTGTAC
GACTCGGACGACGACCACCTGGACTTCCGGTGCTTCCCGAAGGCCAAGCCTGCCGCTGATACGGTGACCAGCATCAGTCGAGCTACGCTGACGTGTCCAT
GCTGGCCTGCTCGGGTTCGTCGTCGGGCTATGAGGCTGTCGGCTCGTCCTCTACTTCAGATCGTTGTTCTCGTGAACCATTATGAAGTGGTTTTACGGTG
GAACTAGATACAGCGAGTATATCTCTTCTACGCGTCCTACTACAGTATATTTTCAACCACCACTACAAATTCTGATCTTTGGCAGGGTTCTTTCGGGTTT
CCCTTACTGTTATAATAATGTGATCCAAGCTGAACAAAGGATACATCCAAGAGTGTGAAAGACTATCAAGTTTATTAAGAAGTGAGTAAACTGCCGAATG
AAAGCCGATGGAAACTATTCATGCATGTGAACGGGGCTTAATGTAAAATGCAGAATTATGCCGAAACATAGCCTGATGATGTTCAAGAAGGCTTGCCATC
GCGGAAGTCGAGCTCAAGAAGGTTGATTCTCCGCCATGAATACAATGTCGCACACTGTGTCGGCAGTGAGTGCACTACGCCGCTTGGTGACCACGTTTCC
TCCTGTGGATAGTACTCTTTCGGAAGGAACTGATGTCGCGATGCACACAAGCTACATCAGAGCTAATGGAGCGATAAGTGGAAACGTCTTGGCATTGCCA
CACCACCAGTTGAGTGACGACGGCTGCTCCTGTTTCCACTCGTTCTGCTGATGACGTCCGCAAGTAGTTCTTGAGTTCCCAGTTACACTCCTTACCAAGC
GACCTAACGTCAGAAGCAGTTCTGCGTGATGTCAATCGCCTTCCATACATGACTCTCTGAAAGGTGGCCGGCTTGAACGCCTCCCTCCGTCGGTCGAAGT
CCGATCTGCGTGAATGCTTCCCTCCGACCAGGTTGAAGTTCCGCTGAATCAGCGTTGTTTATGGCAATTCCATACAGCTTATATGTGGTCTTTCCCATTT
TCAAGAACCCTGGTTCGGTGATTGGCTTGATCTTGACCAATGAGCAAGCCTGTTAATTGTGTGTTATTCTGAGCTAACCAACGAACTCGGACACAATTTA
ACTGTGAAAAATAAAACGTTATTTAACGTTAAAAAAGTAAAGTTGACACCCCTAGTCAGTACCGATGGAGGACCTTACCACCAACTTTAATTCCATCATT
CGCGAGTTCCAGTACCGCAATCACGACTTGCTCGACTACAATAACAACCGCTTTGATCGCGACTACGTCGAGTTCAACGTGCGGATCTCCGACCTTGAGG
GTTTGCTGCAGAAGTTCATCAACGATTCTTTCGAGAACATCACTTCGATCTAGCACTCTCCGAAGTCTGAGCCCGAGGCGCCCTCCAGGACATTGAGTAT
GAGCTCACCAAGCGATGTTGGAGGGGTCGCAGGGCTCGGCGATGAGTTTCAAGGACAGAACAGCGACACGGAACCGACAACGGGCAGAGCAAGCGGAGCG
GCGCGGCAGACGAGAGGAGCGACGAGCAAGCTGGGCTTGGCTCTGGGATGGGTACAGCACTTTTGCGAAGCATGGCAGCCCAAAGCGCAGCGTCATTGGC
GTCGAGATCCGAGTCCCGGTCACCAGATCCATCAAGAACAACCCCAGGTGAGGTTACCGGTGCGTGAGGAAGTGAGAGTGAAGCAGGGAACGTACCAGGT
TGACGACGCAGGCACAGCAGGCTCCACAGTGTCTCTAGGAGGCGACGCAATTCCAGCATTAAGCATCGCAGGGAAAATACCACGACCACCGAGGGAGCTA
TCACAGCCCTCAAGATTCAGGCCGCTTGGTAAGCGGCGTGAGGAAGGAGGGTCAGACGTATCCTCAGCAGTAGCGACGTGAGGCGAGGCGGTTGAACGCC
TTTATTGCCCAGGGCGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTCGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCT
CCAAAAGTACGGGACCTCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATGCCTATAGGTGTCGTTTGTCTTCGGAAGACCGGACTCCACCTGATGAGTT
GTTCCTACACAATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCTCGACGCAATTAGTACAGCTGGGGTTAGACCACTAGCAAAGCCTTCC
CAGATGACCAAATAATACAGAGAGTTATACACAATATGCAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTT
TCACCTGGAAGACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATAT
CCAAAAGGAAAACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGTGACTACTAACAACCTCCTGAA
ACGGCAATTACTATGAAATGGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCC
TAATTTGGTCTTGAGCCTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTAAACCCGGGTCCCCGGAAATCATGG
CGGCTTGTCCGGGGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGTACTCTCTGTTATTTT
TAGTCTCTGCTAGAAGTCTTCTGTCAAAGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCAT
CCGGGAGGCTGACACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCGCACTAATGTATTGGGTTTTGTATA
CTGGAAAATTGGAAAGGTCTTGGTGGGTACAAATCAGCAGCGTCTGGTCGGCCTCCGCGCCCGGAACGTCTGGGTCATCTGCGAGTCGCATCAGAAATGA
GCTTTCGGAAGACACACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCTGTGGGAACTTGTACCAGTTC
TCCGTTCGTCCTCGT