Description :
From Genome Similarity Track
Location :
Scaffold_51:117787- 120096
Sequence
2309 bases(100 bases per row)
GTTTCTCGCTATTTTTCCCATCTGAGCAATCGCATTAGGAGCAGATTATTGGCCTGAGAAATTCGCATCAAGAGCTTTCGAATTGAATGGTGCCGTGGAA
AGTCATTTGTCGCTTCAGCGGCAATTTTAGAGTATTCCCGACTGATCGACCAAATTCACAATGTTTTTGCTCCCCCGTCTTAGCAGGATCTCCTGTTATT
AAATATGGCTAAACCCAAAGCTACAGCGATTGTAACAACAGAAATTAAATTCTTCGATGCGACGAATTCGTGTACACATTGCGCGGTCAAGTTGAGATTA
TTTTCAATCAAAGCAATACTGAAAGATTCACATTAAGCAATATCAATTTAAGAGAATCGAAATCAAGATTCAAAATGAGCTTTGGTGCATTCAAAGTGAA
ACTTCGAAAGATTCAGAGTTTGGCATGCGCTCCTGGTCGTTGAATGGCGAGGACACTTTTGCAATAAACTCCGGAGCAATCTTTGAAGTGATACAACCTC
CGCTCATTTCTCAACCTTTCGCCTCAGCCTCGCATGTCTTCTCAAACCGTCATCCCGAAGCACTCCCCAGCATAAAAGCACCGCGTACTCAACGCGTACC
TCGCAGGAAGAGCGGACTGGCTGTCCGTAGCTGCAAACAACGATATCTCCCGCTTTATGGCCTACTGAATTGCAGATATTGGCCGTGTAGAGCAGGCGGC
GCGCGATCCAGCTTGGTGAAGGTCACACTGGACGTCAAGGAGCAGCTCGAAACGTACCTGAACGAGAACTGCACCTACACCACAGAGGCCTATTCTCTGG
TTCGACCTGAAGGTGCAGCTGTCGACGTCGACTATTAGACGCCCCTTATTAGGTATGCTCTGCATCGTTAAGCAAACTCGAGTCGAGCCTATGACCTGCA
ACAACGAGACAAACAAGACTAAGCGCCGAAAGTTTGCAATGAAGCTCAAGAACCATCCTAAAGAAGGTGACTATATTGTACATTTTTAACGAAACAGACT
TTAACGTGCATTGAAAACGTGGGAGAGGTCGCTCGAAGATTGGCAGGGCTACTGTCATCCTACCGCCTTCCAAAGGTACGAACCTTCAGGTCCATGTGTC
GTGAATTCGATGTCGCTTCTGTACCGCCTCGAGAGAGAGAGAGAGAGAGAGAGAGATACAGCAGTCGGATGGAGCAGAATACAGACTGTATCGAGGCGAT
CTACGAGACCGTGAAGTCATCAGACTTCTTCAAAGCCCCTGCTGTAATGGGCCTAGTGTGTGCCCACTACTTCGGCTTACATATGTGCGCACGTGTATGA
TGAAGTGTTAAGTAGTTTTCCTTAGATTAACTACATTTTCATCCGAAAGTATCGATTAACTTAAATATGTAAAACAAAGCCGATTTACGGTAAAAATGAG
AAGTGTTATTTATGATTTGTGTCTTTGTTTGGGTTTCCTCCTAAAAGTGATATTGTCTATGAAAGGTATTTGCCAACGAGTGGCTGGCAGAATCCTACTG
CTGTAATTGATAGAAATATGTTGCCTTTCTACCAATAGGAAGTCTAAATGCATGCAGGCAGACCAGTGGTCTGACAAATGTATCCATTGATGTATCGCAC
GCCAATGGGAAACCCTACGTAACCAAGTGGCTACTTGCGTGTAACCCCGTTACACCTACCTTGGAAAGAAGATCGTCGACGTATTAGTCATAGCCCACAC
AAGGACAAACAGAAGCCGGATTGATAACGCGCAAAGACCTGGTCAGTCTGCCCTGCCCCCTGATGTGCGACCCCATTGAGGACTACTTCTCGGTAAATCA
CTCTCTATCGAGACGAGATCTGTGATCGCAGTAGCATGGTCAACACGATGCAGTTCCTCGAGCGAGCTTTTCGCAACAGTATTAAGAAAATCACGCCTAT
GTTAGTCACGAAAATGGAACCTCACACTCAAGACGCCGTGAATGTTGCGGAAGATATGAAGGACGTGGTCTAAGGAAAGTAAACGGATAGGAACTGTCTC
CACCTATCCACTTTGAATGCACCAAATCTTATTTTAAATTTCGATTTGCTTTCCCTCAAATGATTTTTGCATAATGTGTATCACTTTGACTGAAAATAAT
CTCATCTTGACCGGGAATGGTATAATCACACATTATTCGTCAATTCACTCCATATGTCAACTCAAGATTGGCCAATCAGAACCAAGAATCATTTTGTTTT
ACTTACTGACAATAGCAATCTATAGTATAGAATAGAGTATGCAGTGGTTGGGTATCTATTCAATCTCATCCCTCAATGTGTCATCGTGCGTGCACATTAC
ATTACACAG