Description :
From Genome Similarity Track
Location :
Scaffold_73:117787- 119997
Transcript NameFunction/comments
Hyaar_Emoy2808064IS891/IS1136/IS1341 family transposase

Sequence
2210 bases(100 bases per row)
GCTACCATTCAGGCTGTACTGTTCCACGAACGAATTGGTGCGGCTGCAAGTAAAGCGCTAGAGCGTTTCTACTGCGAAGTTTGCAACGATTTGGAGAAGC
GTTTAAACAAGAGCTGGAGCAATTACAGCCGCAGTAACAGGCGAGTGGGACGCCCACGCCAGAAGAGGTTGGCGTCGATACTGGAACAACAACATGGACA
CGAAGCTGCGTCTCTAGTTTTTTGCATCAATTTTTTGGCCTTGTTGTATGTACTCTATAGCACGAAGCCGTTTAAGCTCCGTTCCGGATATATGAACGTA
AGATCGATAGTCAATTGCTGCTGTTCAGTGGTGACCTCCGTATAAAATGAGCTGCTGGCGCGATGCACCGGGATCTTGTACGAGTCTATTGTAAGTATGG
ATGTATGTATCGAACTATTCCGAAACGAGCTGCAAGATTTCACTGCAGTCAACTCGAAGGATAAAACACTGCCGTGAGTGATTTGGAAGTATCTCCACTA
TCGCTATGAATAATGCGAACTGGGAATCTGTAACGGGGTTACACAAATGGTTGTGATAACCAGGTACATTGGTGTGATATACACATAAAGAGATCAGTTT
CACTGATAAGGCGTACGTTTGTATCACATACGCCAAGCGGTAATACCATACCTTTTCGATTACGGCTAGATAGTATCTATCGTAATACGGTCTTCATAGA
GGCGACGTAGTTCTGGTGTGGTACACCAGAAGAACTACGATGAGGAACAATTCGATTAGGTAGCACATCTTTAAGGTTAAAGACTTGAGTAAGGTTTATT
ATCGCTATAAATCAGTAAATACATTCATTTCCCCTTTTTATCAGTTTCAGACACGTGTCTTTCTAAGAAGTCTTTGATCGTAAGGGTTAAGAGCCTGTAT
AAAGGCTAGTACTCTTGGGCATTGGTGCTACGTGATTCATGGAGTCATTAGTCCCCTGAACAAGGACTAGAAGCGTACGAGCTTGTTCAGACACTAAGAG
TTAAGTCTCACTAATTCTGTAAATACTTGATACCCCTTAGGTGTATACCCGTTCAATTTAATTCACTAAGAGACTTTACGAGTCTGTAAGTCTTCCTCTG
ACAAAGGAGTTAGGGTAGCTCCGCTACACTTGGTCGCACTTGTAGTCAATCTACCCTGAGTCTGCTAAAGACTGTTCCTCTGTAAGGATTGAAACAAAGA
TAAACCTCTCCTAGGTCCAGGGATTAGCACTGGAGAAACTCAGAGCGCTGGTCGGGATCGAACAAGTAGTTTTTTATCCTCGCACAAGGGCCTGACGTGA
TTTGGGCACGTCTTGACGCTTTTATGCAGTTTGAGTACACTATAATTGGGCAAGTATACAACCATCTGGCATCGGCTATGCCTACTCGGTATGTTCCCAT
ACCTGATAAAGAGCCAAGGGCTCGGCCACTTGTCTTGACTGTAACGACATTTGAGGGAAAAGAAGGGTAGAATCTCCTCCTGTAGATCAGAGAGGTGGAA
ATGGCTATAAACTCCGCTATGCTCCAGTCGGAGCAACAGTGAGTTGGGCGGTCGATCCAGAAAATGGGCTCTCACGTGTAGCACGTCGGTATACGAAGCT
TTCCCCACATGTGATTTGCTAAAACAGCAAATACCTCGGGTGTTCGCTCCGCCTAATCAGGCATATCAAGTGCTTTCTCGTTTCCTATCTGCCCGTCAGG
GCTAGAAAGAACTATCGGACTATGTCCAGGAACTGAGAACTCTAATCGCTGCCATGCAGCTTGATCCCTTACCAGAAATGATTTTGGTCACCATCGTCAT
GGAGGGTCTTCGAACGGGCGTGGCTCGAACGGAAGTGTTCCTGGTACACCCCACCACTTCTAAGGCGGCTGTAGACATCGCGTTGATTACTGAGTTCAAC
TTTAAGGCAGCCCGTTTTAGCACCCACGGGTACAACCCAAACTCGGCAAGCTCATTTAGTTCATTCTATAGGCCGGAGCCTATGGACTTCAGTCTCACCG
AGGCGAACGAAGAAGCAGAGCTTCGAGCTGTAGAACAACATCGAAACATTTGACGATGTTTCACGTGCGGAAGCACAAATCATCTGCGACCTAATTGTCC
TTTACGCAGGGCACGCCAGGCTATTTCAGGACGAACTCCCGCCGCTAACCAGAAGTCTGGTACGGCGCAGGAACGTAGACTCCCAGTAGGCACGGGGTGT
CCCGCTGTGG