Description :
From Genome Similarity Track
Location :
Scaffold_51:117786- 119491
Sequence
1705 bases(100 bases per row)
GGTTTCTCGCTATTTTTCCCATCTGAGCAATCGCATTAGGAGCAGATTATTGGCCTGAGAAATTCGCATCAAGAGCTTTCGAATTGAATGGTGCCGTGGA
AAGTCATTTGTCGCTTCAGCGGCAATTTTAGAGTATTCCCGACTGATCGACCAAATTCACAATGTTTTTGCTCCCCCGTCTTAGCAGGATCTCCTGTTAT
TAAATATGGCTAAACCCAAAGCTACAGCGATTGTAACAACAGAAATTAAATTCTTCGATGCGACGAATTCGTGTACACATTGCGCGGTCAAGTTGAGATT
ATTTTCAATCAAAGCAATACTGAAAGATTCACATTAAGCAATATCAATTTAAGAGAATCGAAATCAAGATTCAAAATGAGCTTTGGTGCATTCAAAGTGA
AACTTCGAAAGATTCAGAGTTTGGCATGCGCTCCTGGTCGTTGAATGGCGAGGACACTTTTGCAATAAACTCCGGAGCAATCTTTGAAGTGATACAACCT
CCGCTCATTTCTCAACCTTTCGCCTCAGCCTCGCATGTCTTCTCAAACCGTCATCCCGAAGCACTCCCCAGCATAAAAGCACCGCGTACTCAACGCGTAC
CTCGCAGGAAGAGCGGACTGGCTGTCCGTAGCTGCAAACAACGATATCTCCCGCTTTATGGCCTACTGAATTGCAGATATTGGCCGTGTAGAGCAGGCGG
CGCGCGATCCAGCTTGGTGAAGGTCACACTGGACGTCAAGGAGCAGCTCGAAACGTACCTGAACGAGAACTGCACCTACACCACAGAGGCCTATTCTCTG
GTTCGACCTGAAGGTGCAGCTGTCGACGTCGACTATTAGACGCCCCTTATTAGGTATGCTCTGCATCGTTAAGCAAACTCGAGTCGAGCCTATGACCTGC
AACAACGAGACAAACAAGACTAAGCGCCGAAAGTTTGCAATGAAGCTCAAGAACCATCCTAAAGAAGGTGACTATATTGTACATTTTTAACGAAACAGAC
TTTAACGTGCATTGAAAACGTGGGAGAGGTCGCTCGAAGATTGGCAGGGCTACTGTCATCCTACCGCCTTCCAAAGGTACGAACCTTCAGGTCCATGTGT
CGTGAATTCGATGTCGCTTCTGTACCGCCTCGAGAGAGAGAGAGAGAGAGAGAGAGATACAGCAGTCGGATGGAGCAGAATACAGACTGTATCGAGGCGA
TCTACGAGACCGTGAAGTCATCAGACTTCTTCAAAGCCCCTGCTGTAATGGGCCTAGTGTGTGCCCACTACTTCGGCTTACATATGTGCGCACGTGTATG
ATGAAGTGTTAAGTAGTTTTCCTTAGATTAACTACATTTTCATCCGAAAGTATCGATTAACTTAAATATGTAAAACAAAGCCGATTTACGGTAAAAATGA
GAAGTGTTATTTATGATTTGTGTCTTTGTTTGGGTTTCCTCCTAAAAGTGATATTGTCTATGAAAGGTATTTGCCAACGAGTGGCTGGCAGAATCCTACT
GCTGTAATTGATAGAAATATGTTGCCTTTCTACCAATAGGAAGTCTAAATGCATGCAGGCAGACCAGTGGTCTGACAAATGTATCCATTGATGTATCGCA
CGCCAATGGGAAACCCTACGTAACCAAGTGGCTACTTGCGTGTAACCCCGTTACACCTACCTTGGAAAGAAGATCGTCGACGTATTAGTCATAGCCCACA
CAAGG