Description :
From Genome Similarity Track
Location :
contig_28:117766- 119659
Transcript NameFunction/comments
g6596.t1hypothetical protein
g6597.t1XP_009534990.1 hypothetical protein PHYSODRAFT_256397 [Phytophthora sojae

Sequence
1893 bases(100 bases per row)
AGCGTCGACGAGCGTCTTCTCGCTATGGGCCATCCCGCCGTTGCATACCAGTACGTGCATACGCACTCGGTGCTCTAAAACCTCTCTCGCAACGTGTCTC
CAAGGCTTGCCTGTCACAGTGATAATCCGTCAAAGTGCTTGCGGATCACCGGATCATTGTCGGGAATGTCGCGCGAACGCTGTTAAATGGCGGTAGGCTG
CTCCAATTTGGCGGTAGGTCGTTCCAATTTGGCGGTAGGTTGCTCCAGCGGCATAATCGCAATTATGCGCTAGGTGGTTCGGTACCGGTTTTTTCTCACC
AATCTCGTCCCAAGGACACGCAGTGTACTTGTCCGGCCAATCGGCGACTCCGGGTGAGCTGTCGTCCCCCTTCATGCTTCTTGCTCTGGGCCACACGCTT
CCTCGCCCATAATTCAAACCTCCGTCAAGAGCCCCAAGCAATAGATAGAGACTTTTTCCGACCATGAGCGCTGTCGACGCCACCCCCGAGCACTCGTCGT
GGAAGACGGAGAACCCGAACCAGGCGCGCGATGCCATCACGTGGGACGCCTACACGAGCGGCCTCAAGGTGGGCTCCGTCACGGCCGTGTTCGCCGCGGC
GGCCGTGGCCTCGGCCAACAAGTACTGGCCGGCCTTCCGCAACCGCCTGAACGTGAGCGGCAAGACGGCGCTGGTGGTGTCGCCCTTCCTGGGCGCCTTC
ACCCTCGTGGCTGAGAACCGCCTGATGCACGGCGCGCGCAACCCGGAGCTGTACATGGCCACCATGGACGGCTCGTACGTGGCCCCCAAGCAGGAGACGT
CGCACCTCAAGTTCTGGCAGAAGAGCGCCAACTTCCTGTACGACCACCCGTACCGCGCCCTCATCACCGTGGGCACCCCACTCGTCGGCGGCATCTACGG
ATACCAGCACATGAACAAGGGCATCTCGGCCTCGCAGCAGATCATGCACACGCGTATCTACGGCCAGGCCTCGGTCGTCGTGCTGCTGCTGAGCTCCATG
GCCTTCCACGATTACATGGCCAAGCGCGGCAAGTTCACGGTCGAGGACAATGAAGATTAGACGGGTCTTGAAGCTTCCGAAGACAGGACGAGAACGCCCC
GACGGCAAAGGCTTGCTATCTCCTCCTGGTTCTCGTTGAAGACCCCTAGCAGCAGCTTGTAGACGAACCTGCGGACAAAAATACAGTGATTTTTATTATT
CGCGCGGCGCCAAGTTAATTGTGTACGTACCTGGAGGGGTTTCACGCCATCACTGCTGGGACGTTTCAAGTTGCCCCCATTGCTGCTGCTCAAGATGGCA
TCAGTTGAGAGAACGCGGGCTCGCAGACGACGCCAAGCAAGATGACGGCCAAGCCTCTCGTACGCCCGAGCGACGTGGATGTCCAGTCGCTGGTAGTGCC
GCTGCCGGAGGGCGTTGAAATGCCCCGCGCTGCTTCGAACCGCCGAGCTGCGTCCAAGGAAAGACGTCAACGCTCCAGCAGTGGCAAGAAACACCCGCCT
ACCAAGCTTACCGCCAACGCCAACACCAATCGCCCAGACAGCTCGCGCATGACGCAGCAGCAAATGCACATGTGGGAGCCCGTTCTGACGCTTGGATGGT
CCATTGGAATCTGCTTCGCGATTGCAGCTCTGTGTATCGCACTTGGGGTCGTCATCGTCTACACGTCCAGCACTCTCACGACACTTCGCGTGCTTTACGA
CGGCAACGACGACACACAAGCAGCAAACGCCACGCAGTCGGACGGCAACGTCTCGCAGCTGGCCAACTGCCGGCTCAACTCGGCGGACGACGCCAACTCG
TTCCATGCCGACCACACATGCTTTGTGCATCTCACGCTGCCGAACGATATCAAGAGCCCCGCGCGCGTCTTCTATGAGCTGGACGGGTACTAC