Description :
From Genome Similarity Track
Location :
contig_7:117756- 122771
Transcript NameFunction/comments
g2333.t1hypothetical protein
g2334.t1hypothetical protein
g2335.t1hypothetical protein

Sequence
5015 bases(100 bases per row)
ATCTTGAACTGCTCGGTGATACTCGTCAGCCGCTACATTCTTCGACGCCAGTACTCGAGTTCTCCCATAGGACCGTCGTCATCAATCGTCTGGTCATTGT
TCCCTTCGCCGTCATTCGTCGTGTTTGTCTCCAAGTAGGTCGAGATGACGTCGCACCACTCCTTCAGCACGTCTTCGTAGTGTGCGATCAACTTGGGCGG
GTCGGAAGCCTGCAACGCCCTCGTACCATTGACCGCATGACCTGCACTGCTCACGGTCTCCGCAAGGATACTGCGGTCGGGTCTTCTCAGCTCCAGGCCA
CTGTCCATACTATTGAGCGCCTCCTTGAGGTCGTTGGCGAACTTCTCAGACTCCGTCATGAACTCGTTCTTCAGATCGGAATCTGCTATCCCCCACTCGT
CCTTCACCTTCTACAGAACGAGTACATTGACGTCTTCGCAGTGCTGAGCCGAAGGACGAAAAGCGTCAGTGACGACACGAAGCGGCGCATCCAGACTCTG
CTTCGGCGGTGGAAGCAGATTGACATCGGCATCACAGAGGCAGCCAACGAAGCCAAAGACAACGTCAAGTACCTGTTCACGCTCGAGAAGTTCATCATCC
CGCTGTACAACGGCACACCCAGCTCCATCATCGATACGCTCCCGGCGCTGATGAACTCGATCAAGATGATCCACTCCATCGCGAGATACTACAATACTAC
CGAGCGGATGGCCAACTTGTTCACGAAGATCACCAACCAAATGATCACCAATTGCAAGCACTGTGTGACGGGGGGGGGGGGAGACCTACGAAGTCATGTG
GGACAAAGACCCGGAAGAGCTCGTGCGGCACCTGGACTCGTGTCTCAAGTTGAACGAAGCCTACCAGCAGCAGTATCGTGTCACCAAAGACAAGCTATTT
GCAACACCCAAGGGCAAGCAGTTCGAGTTCAACGAGATGAAGATCTTTGGGAAGTTCAACCTCTTCTGTCGGCGTGTTATGAAGCTGATCGACATGTTCA
CAACGATTCCACCAGTTCTCGTCGCTGGTTAATAGTGGTGGGTAATCTCTCTATCACGGAAAATAACGTTATTGGGGTTAAAAAGATATTTTTAGCGTTA
CTTTAATACTGTATGATATTTGCAATATCATGAACATGTTTGGCTATATTTGTGTTTTTGGCATTGTAAATTACTCAGCCCGCCAAAGTCATCTTGTGGC
ACATTCGCCGACTGCTCTGAGCTTCTTTCTGGCGGTACGCTGTCGCCTCTGTCCGGCGGTTGATCTGCGTCCGGTGCCCGAGCCGGAGGTGGTCACAGGT
TCTAAAGCTGAAGACTAGTCATTGTGTACAACGAGATGACCGACCTGGTACGGCATCTGCCACGCCGGGACGATCCCCAGTGCGCAGTGACGCCCAACGG
CGCGACATCCCAGCCCATGGACGTCACGGCTCTGCTGTCGGCGGCACCGTCTCGATCAACTCGTACGGCCGTCACTTGAGTGACTCGTACCGTGACCTGA
ACCCTGCTTACTTCCACATCGCCGCTGTGATCCTGCTGGGCAGCCTGAATTCGATCTTCATCGTTGATGTCACGGCCGGTTCGGAGGTTTTAAGATGTGC
CGTGTTCCTAGAAGAGGATGCCCAGACGGCTTGGAGGAACAACCGTAGAGCTCGGCTGCTAAGAGCACCATGTACGCCAAGACTCGTCGTCTCTCGTGGA
TTTTCGAGACGTACACTGATGGACCTCTGGTGCCTTCGGGCTCGTACACGACGGGTGCTTATTACTACTACCTGCTTGAGATGGACGACGCTGGAGCCAT
CATTGATGGTGAGTGGGTGTACGACTCGGACGACGACCACCTGGACTTCCGGTGCTTCCCGAAGGCCAAGCCTGCCGCTGATACGGTGACCAGCATCAGT
CGAGCTACGCTGACGTGTCCATGCTGGCCTGCTCGGGTTCGTCGTCGGGCTATGAGGCTGTCGGCTCGTCCTCTACTTCAGATCGTTGTTCTCGTGAACC
ATTATGAAGTGGTTTTACGGTGGAACTAGATACAGCGAGTATATCTCTTCTACGCGTCCTACTACAGTATATTTTCAACCACCACTACAAATTCTGATCT
TTGGCAGGGTTCTTTCGGGTTTCCCTTACTGTTATAATAATGTGATCCAAGCTGAACAAAGGATACATCCAAGAGTGTGAAAGACTATCAAGTTTATTAA
GAAGTGAGTAAACTGCCGAATGAAAGCCGATGGAAACTATTCATGCATGTGAACGGGGCTTAATGTAAAATGCAGAATTATGCCGAAACATAGCCTGATG
ATGTTCAAGAAGGCTTGCCATCGCGGAAGTCGAGCTCAAGAAGGTTGATTCTCCGCCATGAATACAATGTCGCACACTGTGTCGGCAGTGAGTGCACTAC
GCCGCTTGGTGACCACGTTTCCTCCTGTGGATAGTACTCTTTCGGAAGGAACTGATGTCGCGATGCACACAAGCTACATCAGAGCTAATGGAGCGATAAG
TGGAAACGTCTTGGCATTGCCACACCACCAGTTGAGTGACGACGGCTGCTCCTGTTTCCACTCGTTCTGCTGATGACGTCCGCAAGTAGTTCTTGAGTTC
CCAGTTACACTCCTTACCAAGCGACCTAACGTCAGAAGCAGTTCTGCGTGATGTCAATCGCCTTCCATACATGACTCTCTGAAAGGTGGCCGGCTTGAAC
GCCTCCCTCCGTCGGTCGAAGTCCGATCTGCGTGAATGCTTCCCTCCGACCAGGTTGAAGTTCCGCTGAATCAGCGTTGTTTATGGCAATTCCATACAGC
TTATATGTGGTCTTTCCCATTTTCAAGAACCCTGGTTCGGTGATTGGCTTGATCTTGACCAATGAGCAAGCCTGTTAATTGTGTGTTATTCTGAGCTAAC
CAACGAACTCGGACACAATTTAACTGTGAAAAATAAAACGTTATTTAACGTTAAAAAAGTAAAGTTGACACCCCTAGTCAGTACCGATGGAGGACCTTAC
CACCAACTTTAATTCCATCATTCGCGAGTTCCAGTACCGCAATCACGACTTGCTCGACTACAATAACAACCGCTTTGATCGCGACTACGTCGAGTTCAAC
GTGCGGATCTCCGACCTTGAGGGTTTGCTGCAGAAGTTCATCAACGATTCTTTCGAGAACATCACTTCGATCTAGCACTCTCCGAAGTCTGAGCCCGAGG
CGCCCTCCAGGACATTGAGTATGAGCTCACCAAGCGATGTTGGAGGGGTCGCAGGGCTCGGCGATGAGTTTCAAGGACAGAACAGCGACACGGAACCGAC
AACGGGCAGAGCAAGCGGAGCGGCGCGGCAGACGAGAGGAGCGACGAGCAAGCTGGGCTTGGCTCTGGGATGGGTACAGCACTTTTGCGAAGCATGGCAG
CCCAAAGCGCAGCGTCATTGGCGTCGAGATCCGAGTTCCGGTCACCAGATCCATCAAGAACAACCCCAGGTGAGGTTACCGGTGCGTGAGGAAGTGAGAG
TGAAGCAGGGAACGTACCAGGTTGACGACGCAGGCACAGCAGGCTCCACAGTGTCTCTAGGAGGCGACGCAATTCCAGCATTAAGCATCGCAGGGAAAAT
ACCACGACCACCGAGGGAGCTATCACAGCTCTCAAGATTCAGGCCGCTTGGTAAGCGGCGTGAGGAAGGAGGGTCAGACGTATCCTCAGCAGTAGCGACG
TGAGGCGAGGCGGTTGAACGCCTTTATTGCCCAGGGCGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTCGCCTTTCGGAAA
GCCCAATGGGGTCAGACTACCTCCAAAAGTACGGGACCTCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATGCCTATAGGTGTCGTTTGTCTTCGGAAG
ACCAGACTCCACCTGATGAGTTGTTCCTACACAATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCTCGACGCAATTAGTACAGCTGGGGT
TAGACCACTAGCAAAGCCTTCCCAGATGACCAAATAATACAGAGAGTTATACACAATATGCAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTC
CGTACACCAGTCTACTTGTGTTTCACCTGGAAGACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCC
AGAAGATAACTTTCAGATATATCCAAAAGGAAAACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGG
TGACTACTAACAACCTCCTGAAACGGCAATTACTATGAAATGGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAA
TGCGCGTCACTCGGTCACCGCCTAATTTGGTCTTGAGCTTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTAAA
CCCGGGTCCCCGGAAATCATGGCGGCTTGTCCGGGGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGC
AAAACGTACTCTCTGTTATTTTTAGTCTCTGCTAGAAGTCTTCTGTCAAAGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAG
GGTTCTTTGGCGTAATCAGCATCCGGGAGGCTGACACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCACT
AATGTATTGGGTTTTGTATACTGGAAAATTGGAAAGGTCTTGGTGGGTACAAATCAGCAGCGTCTGGTCGGCCTCCGCGCCCGGAACGTCTGGGTCATCT
GCGAGTCGCATCAGAAATGAGCTTTCGGAAGACACACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCT
GTGGGAACTTGTACC