Description :
From Genome Similarity Track
Location :
Scaffold_73:117731- 120432
Transcript NameFunction/comments
Hyaar_Emoy2808064IS891/IS1136/IS1341 family transposase

Sequence
2701 bases(100 bases per row)
AAAATGGACATATGTAGACCGCGTACGGCGGTCTCGTCATGATTTCGCTCCAAAGCGCTACCATTCAGGCTGTACTGTTCCACGAACGAATTGGTGCGGC
TGCAAGTAAAGCGCTAGAGCGTTTCTACTGCGAAGTTTGCAACGATTTGGAGAAGCGTTTAAACAAGAGCTGGAGCAATTACAGCCGCAGTAACAGGCGA
GTGGGACGCCCACGCCAGAAGAGGTTGGCGTCGATACTGGAACAACAACATGGACACGAAGCTGCGTCTCTAGTTTTTTGCATCAATTTTTTGGCCTTGT
TGTATGTACTCTATAGCACGAAGCCGTTTAAGCTCCGTTCCGGATATATGAACGTAAGATCGATAGTCAATTGCTGCTGTTCAGTGGTGACCTCCGTATA
AAATGAGCTGCTGGCGCGATGCACCGGGATCTTGTACGAGTCTATTGTAAGTATGGATGTATGTATCGAACTATTCCGAAACGAGCTGCAAGATTTCACT
GCAGTCAACTCGAAGGATAAAACACTGCCGTGAGTGATTTGGAAGTATCTCCACTATCGCTATGAATAATGCGAACTGGGAATCTGTAACGGGGTTACAC
AAATGGTTGTGATAACCAGGTACATTGGTGTGATATACACATAAAGAGATCAGTTTCACTGATAAGGCGTACGTTTGTATCACATACGCCAAGCGGTAAT
ACCATACCTTTTCGATTACGGCTAGATAGTATCTATCGTAATACGGTCTTCATAGAGGCGACGTAGTTCTGGTGTGGTACACCAGAAGAACTACGATGAG
GAACAATTCGATTAGGTAGCACATCTTTAAGGTTAAAGACTTGAGTAAGGTTTATTATCGCTATAAATCAGTAAATACATTCATTTCCCCTTTTTATCAG
TTTCAGACACGTGTCTTTCTAAGAAGTCTTTGATCGTAAGGGTTAAGAGCCTGTATAAAGGCTAGTACTCTTGGGCATTGGTGCTACGTGATTCATGGAG
TCATTAGTCCCCTGAACAAGGACTAGAAGCGTACGAGCTTGTTCAGACACTAAGAGTTAAGTCTCACTAATTCTGTAAATACTTGATACCCCTTAGGTGT
ATACCCGTTCAATTTAATTCACTAAGAGACTTTACGAGTCTGTAAGTCTTCCTCTGACAAAGGAGTTAGGGTAGCTCCGCTACACTTGGTCGCACTTGTA
GTCAATCTACCCTGAGTCTGCTAAAGACTGTTCCTCTGTAAGGATTGAAACAAAGATAAACCTCTCCTAGGTCCAGGGATTAGCACTGGAGAAACTCAGA
GCGCTGGTCGGGATCGAACAAGTAGTTTTTTATCCTCGCACAAGGGCCTGACGTGATTTGGGCACGTCTTGACGCTTTTATGCAGTTTGAGTACACTATA
ATTGGGCAAGTATACAACCATCTGGCATCGGCTATGCCTACTCGGTATGTTCCCATACCTGATAAAGAGCCAAGGGCTCGGCCACTTGTCTTGACTGTAA
CGACATTTGAGGGAAAAGAAGGGTAGAATCTCCTCCTGTAGATCAGAGAGGTGGAAATGGCTATAAACTCCGCTATGCTCCAGTCGGAGCAACAGTGAGT
TGGGCGGTCGATCCAGAAAATGGGCTCTCACGTGTAGCACGTCGGTATACGAAGCTTTCCCCACATGTGATTTGCTAAAACAGCAAATACCTCGGGTGTT
CGCTCCGCCTAATCAGGCATATCAAGTGCTTTCTCGTTTCCTATCTGCCCGTCAGGGCTAGAAAGAACTATCGGACTATGTCCAGGAACTGAGAACTCTA
ATCGCTGCCATGCAGCTTGATCCCTTACCAGAAATGATTTTGGTCACCATCGTCATGGAGGGTCTTCGAACGGGCGTGGCTCGAACGGAAGTGTTCCTGG
TACACCCCACCACTTCTAAGGCGGCTGTAGACATCGCGTTGATTACTGAGTTCAACTTTAAGGCAGCCCGTTTTAGCACCCACGGGTACAACCCAAACTC
GGCAAGCTCATTTAGTTCATTCTATAGGCCGGAGCCTATGGACTTCAGTCTCACCGAGGCGAACGAAGAAGCAGAGCTTCGAGCTGTAGAACAACATCGA
AACATTTGACGATGTTTCACGTGCGGAAGCACAAATCATCTGCGACCTAATTGTCCTTTACGCAGGGCACGCCAGGCTATTTCAGGACGAACTCCCGCCG
CTAACCAGAAGTCTGGTACGGCGCAGGAACGTAGACTCCCAGTAGGCACGGGGTGTCCCGCTGTGGAAGAACTAGGTTTTGTTGAGCCTCTAGGAGGTAG
TGGCGAGAAGAACTTAGCCTCAAGGAGTCCCGTGCACTCTAACACGGGACGTAAATACAAGCTAGTCTTGTTGGTTGCAAACGCAACTGTTAAGGGCTTA
ACCAAACCCTGGTCGATTTGGGCGACTCCGGAGCATCCGTTAATTATGTCAGACTCTGTTCCATTGACGAGAATCCACGTTACCTTGAGGCGCTAGAAGC
GCACAAGGGTGATATGTTCACTATTCGCTTGAAGACAGGAACTCTATTGACTGCACCCAAAGTCCCTGTGAGCTTAGGTTTGAAGTTTTTCGATTTTGAT
AGTATCGAACGCTGATTAGTCCTTGAGTGGAACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTGAGCGCCATGAGCCATGGATCGACTGGAGATC
G