Description :
From Genome Similarity Track
Location :
contig_31:117726- 119604
Transcript NameFunction/comments
g6059.t1serine protease family S09X, putative
g6060.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GGAGATCTTCTTGTCCGTAAAGCACAACTCGTTGTCCGACCCTGGAACGCCACCGAAGTTGAAGGTCACGAAGGCCTTCTTCCTGTCCTGTTTGCTCACC
CAAAACTCGGCCAGCTTGGCAGATGTTCGGGATGCAAAGTCTACCTTGGTAGGGTGCACACTCATATCCGGGAACCCGTGGAGATACACCATGACTTCGT
CGTAACTCTCAGCAGCCTCCTTGCTGACGTCATCCGGCGTGGCTAGAATCGCCAGCAAGTTCCTGCTCACCCCCGTTGCAGTCTCAGTCGCTGGCACCTT
CACTATGACATGACGAAGCTGCATGGCATCAGTATCTTTATTTTTCTACAAGCCCAACACTATTGGAAATGAAACACTGCCGTCGCGTGACTTGTTTTTT
GTATGTTGAAAATTTGAAATTTGTTATTCCTTTGGTAACTAGGGTAAGTTACACAAAATTGTATTTTCAGAATTGAACACGAATATGCCTCCAGTGCCGC
CTGGACGCCGGGGAGACAAGGGCGCTGCGGCGTCCACGGGGCCCGACGACAACGTGCCGTGCAACTACTGCGTGGGCATCAGCATATACACCAGGTAGAC
GCTTCTCCGGTCCAAATGCGCCCTCGGGTTATGCCAAAATAGGTACTAAATCATAATATGGTGGAATTATTTAGAGCCATGTGGAAAGAACGTCAAAGCC
CTGAATGCAAGGGTCTTCAAGTGGATTTCTCGACTAGTCGCGAACGTTTGCAGGATATGAGGGAACGAGCAGGTGAAGATGAGAGACTTGACTTTTTATT
CCGGTTCGAACGGGGAATTTTAACGAAGTTTTGATAATGTTGTGGATGGTGGTACCAGCTCCCCCTAGGAAGGATGACTTCACCTTCATGGGCGTCGGAC
TGTCGGTGTACTCTCCGGAGTGGATGGAGGAGGGCAAACGCTTGCCTTACGTCCGGGGGATCGGGGTCATTGCGGTCCACACAGACAACGGCGAGCTCAT
GAAGCTGATCGAGGAGCGTAAGCGCATCAAGCGCGAACTGCGGAAAGGTGTGGGCAATAGGGGAGACCTGCAGGATCATGGAGACGATATCGATCAGGAG
GAGGAGGATGTGGTCGAGGACAAGGGAGATGAGGACTTGTTCGACTTTGAAGATGGAGAGGCAACGGATGACGGCCAAGCACTCGTGGAGAGCGAGGTGG
TGCGGGGTATGAAGAAGCCGCGGGGACCAGCAGTGATCCCGGCGGAGATTACCATGGCCGAGGTCAAAGATCGAATGGTGGAGAAAGCCAAGTACTCGGC
GAATGCAATGTACAAGTTCTGGGAACGCCGTCTGGACGGATTCAGTGAGCGGTATGTGGACTCGTGTCGACGACTGACGGAGCAAATGGAGAAGCAGGCG
GTAAACACGCCGCATAACGTGATGTGGCTGGTGCATCGAATTGAGGAGTACATGCGTGGCAAGGATGATGATGGCAACAAGTAATAACGGAGGATTACCA
GTACGCCGTCCTGGCAAGCGCGTGAGACTGAGGGTACAGGAGCAACTCTGATAAACAAGAAACGGAAGGTGCCGCGAGACAAAACAGTATGCGGAGGATT
CACGCATTCTCTCAGGGTGCAATTCAAGTTGGTGTCTAGCAGATGCTAATACTAAGTATGCACTCGCATTTCAGGAATGCGTTGCCCGTCGTGCTGAAGT
CGTTGGCACTCTCAGTCATGTCCGTCTCCTGCGCTGTAGCTTGTGACCATTTTGATATGGCGAAATGCCTACTGGAAAGTAATGCAGCAATGAACTTACG
CGATAACGTTGGCTGGGCAGCTTGTCAACGCGGTCAGAAGCGTCGGCGAATGTTCAACCTCAGCGCCGACTCTGTTGT