Description :
From Genome Similarity Track
Location :
Scaffold_29:117705- 119348
Transcript NameFunction/comments
Albla_Nc14032010cysteine protease family C26 putative

Sequence
1643 bases(100 bases per row)
TCGCAGTCGGTAGCAATCGGCAGTCACAATCACACTCACAAAAGATATTTTGGTATCATAACGCTACATATCAAGTTTGGCAATTTTATACGGGATAACT
AGATGCTTGATAAAGTTTCGCGATTCACAGAGTCGGATGGTTTCGTCCATAATGTCCGCATCAGCGCCAATTTTCCATGCGAGGTCGTACCGTGTCGGAT
CGATATGAAGATTCTCCAGTGTGTCTATGTAGTCATCGGCGCTCTTCCAGTCTCTAAAGAATCCAAGCTCGATCAATTTCTGACGACGACAATAGATCAA
TCGCGCCATTTCATGGAGATCGTATTCGGGATGATACTGTACTGCCCAAAAGTCGCCCTAATCAAAACTCTCCTCAAATGTCTACCCTCAAAGAACAATT
CCCTCATACTTGAAGATACCGCACGGCGACCGCCTGATTGGTCGAAAATCTATTCCCAGCCAGTGTGACTCCTCCCGTACTCAAATGAGTGATTTCATCA
TTATGACTCGTGAAAGCATCAAACAGAGATGGCTTTCCTTCAAACAGAGGATGTGCTCGACCTTCTGGTGTCAATGCAATCTTTCTCGCAATTCCCATTT
CTCTCCCTCGTGGATTGCGAGCACATATTCCTCCCGATGCAGCGATTGCAATCTGCGCGGCCCAACAACTTCCATATTGAGGGATTCCTATCATCAAACA
TGAGTAACGGTATACTATAGTATAATGAATCAGACCGTGAGCAAACAAGGTTGTGGCCAATCGGATTTGTTTTTGCACACACGCGTCTTGTCCCTCATGA
ATTGTGAGGGAACAACCCGTCCAAGCTACAGCATCAAACTTCATTTGACAGTTACATACATTCCGTGCGTTTACATGCTTTACGATGGCACCTTTGCTAG
CGATGGAAGTTGAAAGCTTTCATCAGCGGGATACACAATATCACATTGCACATCATTGTTGGTCGACGCAGATTGCGTGAGTAGTTTTGTGTATAGTTCG
CCTGCAGTAGAAGCGCCTCCTTTTTGCAATTCGCGTCTTCCCTCTTGAGTATACCCATCGATTACGAGGAACGAGAGTGTCGTCTTGAACTTTGTATGAG
TTTGGATCCTCAGTAAAGCTCGTTGAGTGGAATGAGTGCGAAAGGTAAACATTGCGGATGTTTTCTTGAAGTTGACTGACGGTAAGTATGGTGTATTCCA
CACAACATCAGTAAGGCAAGATCGCTAGATCATTCAAACAACCGTAATAACACTAGAAAAGTTGGTTGGCTGGACCACAAAACTGTTATCTGAAATCATT
ACAAACTCTCGAACCGCGTTGTACCTATTTCGGTTCATTCACTGCGATGCGCACAGCAATAATGTAAAGTCGTAGATCGGATCCAATCTGATTCAAGCCC
TCTAGAAATTCAAACATAACTGAAATCTAAAGAACAAATAAAATATATTTCATCAAAAAGAAACTGAAGTGCAAAAGTCAAAGCCAAACGCAATTTACGT
AGCGCTGTATTAAGGGGCGTACTCACCGAGTTTGTAAGCGTATTGGAAATATACACTTGCAGCCGCAAACGTGTCAAAACGTACCCGAGGAAAACGTACT
TTCGCCATGAGTAACGTACCGATTCAATTGGGTCATTACCATT