Description :
From Genome Similarity Track
Location :
contig_59:117622- 120640
Sequence
3018 bases(100 bases per row)
CGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAATGTCGATTACAAGACGCCACTGCATGCCCTCACGGGTAAGCCGCCGC
GGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCACAAGACTGGAGTCTCAGTGAAGAAACGAGCGGAGAAAGGAGCCATCAT
CGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCACGTTTTTCGATGATCTCGGCGAATATCCCTCGCAATAAATTAAGC
TCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAAAGCACAGTTAGCTAGCATATAGCAGTGAACACACAATTCGATAA
ACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAGTAGAGCACAGATGCGTGTGGGAAGCCGACAGTGGCTCCTGCAAG
TTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGAGGGCTCGTACCACTGGTATAGCGACCGCTTCGTTAAACACCAGT
TTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGGTAGCAGGGTTAGAGTTTCTCCATATGCACAGCTTCCCGCTGACC
CTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTCTCAGTTTGGACTGCAACGTATTCTTCATTGCGCTCTCAAAGGGC
TTGAAGACGGCAACATCAAGTGGTTGATACACGTGCGTCGCATTATCGGCAGTATTACCTCTAGTATCTTCATGTTGAGTGCTGCTCCATCAGATTTTAC
CCAGCACTAAGGGATCGATTTTGGTGAAACTTATTCTCCAGTACTCAAGATCACCAACTTGCGTCTGCTAGTTGCGCTGGCAGCAGCTTGGAGACATCGT
TTGCGACAAGGCCACGTGCCAAACATATATGTCAAGGCCACATTGTATTGTCCGACGTTGATGAAGGCCCCTGCGGTACGTCGGAGGGCAATCACACTGC
ATGACTGCTGCGGAAGTCACTTTATGGTTGAAATAGAGTCATCTTCGATGAAACAAAACGGTCAACGCGTTTTTGCTGCCTTTGGGAACTGTAAGAATCC
GCTCCCTCCTGGATTCTTTGCGCATCCCTAAAGTACCTCGCACTGGCCCTTAATCCTGAATGATTGTGGTTGTACCGCCAAAGTGGTACATCACGATCGT
AATTGTGATCGTGGTGGCGATTGGGATCCGGCGTATCGAAATCATTGTACCGTATATCGATCTGATCGTGGTCGTTTGGATCGGCTCATCAGAATGATTG
CGTATATCAGAATGATTACGCTTGCGACACGACTTGAGACGTGACTTGGGACACCACGTGTCTCTCATAAATCCTTCTACGCACTTGCCACACAAGTGGC
GTGATATTCTCCTATTTGTGGATCGTTTAGCAGATTTAAGGGTTTCTCGATGGCACGTGTTTTTTTTAACATTGTGGTTGGATGGTAGATAGACACTTTG
ACCCTACTCGTCCAATATCAATGGAAAGAAGGCAAATGCCATACATTTTTGAGCACATGCATCGAAAAGAAAGACTTGAAGAGAAGCTCGGCTTTTCGGG
GCGACGCACTTCATCAGCAGGCTTTCATCAATTTACAGAGCAACGAAAGCAACAGACGCTGACGAGTTGCGATTTTCTGGATCGACGAGATCGTGGCTTC
ACCAGTTGTTGCTCTTCATGACGGTGATAATAAAAAGATAATAGTTTGGTAAATACGGCGTGCGGTCGAAAGGTGCATGTCATCAAATGCATCGTCCATT
AACTAAATACCCCTGTGACAGGGCTTCAATTTAGACGCTACTGTTGATGTTCAATATCATCAAGGTGAGCCATGCCTGGAAACGGGTCATATCGCTTAAC
GGAGGCGGACGGGTGTCTGCCAAGATTGTTTCAATGGTACGCTTACGTGACTCTAGATGGAGGCGTTGACCGTTCAATCGCCCCCGAGCGCCTTCCAGGT
TTCACCTAGCTCCCTGTTGTCTTATGTGGACGCATCAACGGCTTCACGAGCCACGGATGTCGAGCGTAACGTGAATGGCTTGACAGCTGCCGCTCAGCTG
GCAAATCAGCAGACTGGAGAGTTATCTTATATCGCATGATTCCAAGTAGAATGGTTTAAGCCACGCATTTTGTGGTTTGCCCACATTCGTCACACGACAG
GGCCAGTCTGAAACGTTGCTGCCCATATATCTTGCAGCTGAGCTACGACGCCTCGAAGCGAGCTCTCAGCTGCTGCACCTGAGCGATCAGTGAAAGCCGG
GCGAATGCACGCATCAAGAAATTCTTCCAAATCTTGTGCCTTACTAATGACCATTTCATATTCGTATATCATGAGACAAATAGCTTCTCTGCGAGTTGAA
ATAACTCACCGCCTCAAGCTTGCTCAGTCTTAGCGCTGTCGAACAAGTGCTGGTTCCCTTTAAACTGCACCTCGCGGTCTCTGCAACAATCCAGGTTCCT
TCCTGCCTCACAAATTGACTTTTAACGCGGGAGCTGAATTTGATCCATAGCTTGTGCATAACGTTTTGCAATCTCGCGCAATTTACAACGAAGTCATCTA
ACGTCTTGCCTAACATCTCGCGCTGCCCGACCGTGCTGTTCACAGTTGATCGAACTGCCAGCTGTAGCCGATGTTGCTCCCCAGTTGATGGTGCAACTGG
CGATGCGGGAGATACAGGTCGGCCAGCGTTCGTTGGGGCCGCTGGTGGTGCATCTGGAGATGCGAGAGATACACGTGTAGGTCGTCCAGAGCGCGTTGGG
AGAGTGGTGCCACCATATCCGCAACCAATGCATCGGATGTACGGTTGCACGTGATCATCACCAACAAACGACGCTTGAGGAGGTGCTCTCTGGTGCCGCG
CTTGAATCCACACCGCTG