Description :
From Genome Similarity Track
Location :
contig_28:117619- 119512
Transcript NameFunction/comments
g5588.t1hypothetical protein
g5589.t1hypothetical protein PHYSODRAFT_288549
g5590.t1hypothetical protein PHYSODRAFT_256397

Sequence
1893 bases(100 bases per row)
GTGCTCTCAAACCTCTCTCGCAACGTGTCTCCAAGGCTTGCCTGTCACAGTGATAATCCGTCAAAGTGCTTGCGGATCACCGGATCATTGTCGGGAATGT
CGCGCGAACGCTGTTAAATGGCGGTAGGTTGCTCCAATTTGGCGGTAGGTCGCTCCAATTTGGCGGTAGGTTGCTCCAGCGGCATAATCGCAATTATGCG
CTGGGTGGTTCGGTACCGGTTTTTTCTCACCAATCTCGTCCCAAGGACACGCAGTGTACTTGTCCGGCCAATCGGCGACTCCGGGTGAGCTGTCGTCCCC
CTTCATGCTTCTTGCTCTGGGCCACACGCTTCCTCGCCCATAATTCAAACCTCCGTCAAGAGCCCCAAGCAATAGATAGAGACTTTTTCCGACCATGAGC
GCTGTCGACGCCACCCCCGAGCACTCGTCGTGGAAGACGGAGAACCCGAACCAAGCGCGCGATGCCATCACGTGGGACGCCTACACGAGCGGCCTCAAGG
TGGGCTCCGTCACGGCCGTGTTCGCCGCGGCGGCCGTGGCCTCGGCCAACAAGTACTGGCCGGCCTTCCGCAACCGCCTGAACGTGAGCGGCAAGACGGC
GCTGGTGGTGTCGCCCTTCCTGGGCGCCTTCACCCTCGTGGCTGAGAACCGCCTGATGCACGGCGCGCGCAACCCGGAGCTGTACATGGCCACCATGGAC
GGCTCGTACGTGGCCCCCAAGCAGGAGACGTCGCACCTCAAGTTCTGGCAGAAGAGCGCCAACTTCCTGTACGACCACCCGTACCGCGCCCTCATCACCG
TGGGCACCCCACTCGTCGGCGGCATCTACGGATACCAGCACATGAACAAGGGCATCTCGGCCTCGCAGCAGATCATGCACACGCGTATCTACGGCCAGGC
CTCGGTCGTCGTGCTGCTGCTGAGCTCGATGGCCTTCCACGATTACATGGCCAAGCGCGGCAAGTTCACGGTCGAGGACAATGAAGATTAGACGGGTCTT
GAAGCTTCCGAAGACAGGACCGAGAACGCCCCGACGGCAAAGGCTTGCTATCTCCTCCTGGTTCTCGCTGAAGACCCCTAGCAGCAGCTTGTAGACGAAC
CTACGGACAAAAATACAGTGATTTTTATTATTCGCGCGGCGCCAAGTTAATTGTGTACGTACCTGGAGGGGTTTCACGCCATCACTGCTGGGACGTTTCA
AGTTGCCCCCATTGCTGCTGCTCAAGATGGCATCAGTTGAGAGAACGCGGGCTCGCAGACGACGCCAAGCAAGATGACGGCCAAGCCTCTCGTACGCCCG
AGCGACGTGGATGTCCAGTCGCTGGTAGTGCCGCTGCCGGAGGGCGTTGAAATGCCCCGCGCTGCTTCGAACCGCCGAGCTGCGTCCAAGGAAAGACGTC
AACGCTCCAGCAGTGGCAAGAAACACCCGCCTACCAAGCTTACCGCCAACGCCAACACCAATCGCCCAGACAGCTCGCGCATGACGCAGCAGCAAATGCA
CATGTGGGAGCCCGTTCTGACGCTTGGATGGTCCATTGGAATCTGCTTCGCGATTGCAGCTCTGTGTATCGCACTTGGGGTCGTCATCGTCTACACGTCC
AGCACTCTCACGACACTTCGCGTGCTTTACGACGGCAACGACGACACACAAGCAGCAAACGCCACGCAGTCGGACGGCAACGTCTCGCAGCTGGCCAACT
GCCGGCTCAACTCGGCGGACGACGCCAACTCGTTCCATGCCGACCACACATGCTTTGTGCATCTCACGCTGCCGAACGATATCAAGAGCCCCGCGCGCGT
CTTCTATGAGCTGGACGGGTACTACCAGAACCACCGGCGCTTTGTCTCGTCCATCATTCGCACGCAGTTCACGGACGAGTGGCGCCCGGACTC