Description :
From Genome Similarity Track
Location :
Scaffold_6:117616- 154462
Transcript NameFunction/comments
Phyta_totarag464hypothetical protein PHYSODRAFT_537335
Phyta_totarag465hypothetical protein PHYSODRAFT_353568
Phyta_totarag46660S ribosomal protein L38
Phyta_totarag467conserved hypothetical protein
Phyta_totarag468hypothetical protein PHYSODRAFT_469761
Phyta_totarag469hypothetical protein PHYSODRAFT_476831
Phyta_totarag470hypothetical protein
Phyta_totarag471aspartate aminotransferase, putative
Phyta_totarag472protein kinase, putative
Phyta_totarag473hypothetical protein PHYSODRAFT_472892
Phyta_totarag474hypothetical protein
Phyta_totarag475hypothetical protein

Sequence
36846 bases(100 bases per row)
TCAGTTCAAATGTTTCTcttgtttgttgttgttgtgggCTCTAAAACAATAAGGAGGAGAGATTTGCTCTATCTTCCGAAGTGACTACCTACTTGGACTG
AGTACGCGGGCGGCGAGCGGTCTTGGGTCGACGCGAAGGTGTTGACTGTCGACGGGAGTGGTGCTGGCTGTTACGTGGCGTTGTCGTCTCCGAATCCTTT
GAGGACGTGGAAGCGGTCGAGGAGTCCTCGCTACTTTCTGTACTCAACAGAACACGGCGGGACATCTTGCCGGAAGCCCCGTCCTGCAGGCACTCGAACT
CCATATCTTGTCCCTCCGACACCACGTCGCGGATGTTGGTGACCTTGTCGCGCGAGAGTTCAGAAATGTGCACGAAACCACGCTGACCAGCAGAAGACTC
GAGGATCGCACCGAAGTCCATGACCTGCGTCACCCGCATGGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGTTGGAGCCCAGGTGGTCA
TTGTCACGACTGTTGCCAcagtcgttgctgttgccgttgttgttgttgttattgcCACGAGGGCCAGAGTTGGCAAGCCCAGCGAGTTCTGTGCGCAGCC
ACTCGCGAGCTTTGTCAGTGTCTTCAGCTGAGCCAACGACACGCACAATGCCTTCACGGCGATCCACGATGCTGATAGAGACGTTGAAACGCGATTCCAG
GTCGCGAATGTTTTTACCTCCGACACCAATCAGCGCACCGATCATGTTCGTGGGAATCATGCACTCTACGCTCATGTTCGGCAGTCCACTGCCACTAGCC
TTCAGGTTCTCGCGTGGTTCAGCGAGTTCGCTGCTCATGCGACGGAGCACATGTAGGCGAGCCTGCTTGGCTTCGCGCAGTCCCTCCTTCAGCACAGGAA
GCGGCACGCCACCAGGAAGCTTCACATCCAGCTGCAGTGCCGTCACACCAGATGTCGTACCTGCCACCTTGAAGTCCATGTCACCATAGTGGTCTTCAGA
GCCAAGGATGTCGGTCACCAACTGGTAGTCACCTTCTTCAATACGCTTCTCTTGACCAGCAAACGGGTCGCCCGCAGTAACAAGACCAATGGCAATACCT
GCAACTGCACGGCGAACGGGAACACCGGCGTCCATGAGCGCCAGCGAGACACCACACACTGTAGCCATAGACGACGAACCGTCCGAGCCCACCACCTCCG
AGGTCATGCGAATGGTGTACGGGAACTCAGTGATAGACGGCAGAATAGGCAGAACGGCCTTCTCTGCCAGAGCGCCGTGGCCGATCATGCGTCGATTGGT
GCCACCCACGCGGCCAGTCTCATTCACACAAAAGGGCGGGAACTCGTAGTGCAGCATGGCATTTTTAAGCGGCGTAGGAGCATTAGGCTCAGCCTGCTCA
CGCGCTTCATAGAGCGCACCACGGAGACGAATACCACGTTCCAGAGGTCCCAACGTCACGGAACACAGTGTCTGCGTCTCGCCACGAGCGAAAAGGGACG
AACCGTGGGCCATCGGCAGCGCACCAGCTTCCATCTCTAGCGGACGCACGATGCGAACCGATCGACCATCGAGTCGCACGGGTTTGTTCTTCGCGCcctt
cgtctccttcgccATTGTCAAAATACGCTCACGCACCACACGCTGGAACGTGTCATGAGCTGCACGCTGAATAGCCGCATCATCCACAGGGGGAGACGCG
TTGGCATGGTGCTGACGCATGCCATTGAGCATCTTGCTGTAGACTCCACGCTCTCCTCGTTGACGAGCGAGTTTACCAACGCGACCACTGGCGATGAACG
CCTCGGCATCCTTGCGTcccagctcctcggccttggCCCAAACTTCTGGTGCAATGTACAGCGGCGAGTACACGCGCTTTGGCTTTATGTGTTCTCCAGC
AAGTTTCTTCTGCGCTTCAATTGCCGGCAGCACATTCGCCTGCGCCAAATCCAACGCCTCATCAAGACGCGCCTCGGTCACCTCGTCGCCCGAGGCTTCA
ACCATAACGGCACGTTCAGCTGTACCAGCATAGAGTACATCCAGCGTAGCGGCATCACGCTGCGGGGCAGTGGGGTTGACCACCAGCTGGCCATCGACCT
CAACGACACGTACGCAACCAACCGGCCCATTCCACGGGATGTCCGACATAGTCAGCACCGCCGACGCCGAGTTGACAGCCACCACGAGCGGGTCGTTGTT
GGGGTCGTACGACTGCACCGTCGCCAGCACCTGCGTGTTCTCGCAGTAGTCGCGCGGGAACAGTGGGCGGATCGCGCGGTCAACGACGCGGgactgcagc
acctcctcgtcgctgccagTGAACTCGCGACGCTTCTGGTTGTCCGGGATGAGACCCACAGCGTACGACTTGACGCGGAAGTCCACCGTGAGCGGCAGGA
AGTCGCGCTGGGCTGATCCGCCGCCGGCCGACGGGTTGCCATTGTGGTCGCCGCTCACGACCGTCGTGAGCAGCACTGTGCGACCGCACGAGGCCAGCAC
GGCGCCATCCGCGAGCTTGGCGAGCTTCCCCACGGTGTAGGACGTGGCGTCCGAGCTGCCGACCACCGgattctcttcctccttggGCTGCTGCACCTGA
TTCTGATTCTGATTCTGATCCTGCTTGGGCTCTGACGacgcttgtgcttgttgcaccttggcggcctcctcctcagccGACGGCTTCTTGGCGCCGAACA
GGAAGTCACGCAGACCCAGAAACCCGCGCGACTGCGGCGCGGCGCCTGCGACACGAGGAACACGGCATTGAGCTGCGGTGATGTTGGCGCGGCGAGCCAC
GGCCGCGGCCGgcagtcgacgagctgcggTGGACAGCATCTTGATGCGGATGACCGATGTGCGGCAATGGTGGCTCGAACACCAACAGTCAAAATGACGT
TAGTGTGTGCCACATAAGGTCAGCGAAACCAACCGTCTTTGTGCAGCTAATCGACCAACACAAAGAATGCAATTTATACCTTTAACGTTTGTAATCGGTT
GTCAAGTAGCACAACTTTAAGGACTTTGTACTGGTTGAATAGCGGATTGGTGGAGTTCGCTTCTTCCCAGTCACAAACCGAAAGACCAGTCCGTCCGCAA
AGCGCTGACCGACTCCCGCCTCCCCCCTTTCAAGACCCCCAAGACCAGATCAGCAGCATGGGCACTCGAGTGTACGTTGGCGGCCTCCCGCGCGACGCCA
CTTCGCGCGAGATCCAGGACGGCTTCAGCCGCTACGGCCACGTGTCCAACATTTGGGTGGCGCGCAACCCGCCTGGCTTCGCTTTCGTGGTGAGTTgagc
tgctcttcctcttcggcgCGAAGCCTCGCTTGCATGATGATGGCGCACCGAcgttgcccccccccccctctccCTCCCTCTACTCTCCCTCTTTTCCCTC
TCCGCACTACCCTGTCGGCACTGCGGTTCAacctcgacgtcgacgttgaTTCCAAGCACTCGGCGGTCTGTCTGTGACAATGTGTGTGTCTTTTGTATAG
ATGTATGTTGTATACTATACGTGTGTATTCATGTATACACGTTGAACGGTGACCGCCGCTGCCGAGCCTCCCGTGTGATGATTATGGTCGCCTCGTTGAG
CTCTGCAGACTCTGGGTTGGTGACAACTTCGTCTGCTGCTACTCTGTGGGTCGCTTCGCCGTCTCCGGTGCTTCCTTCTACTGCTGGAGGGAGAGTTAGA
GAATCAACAACGTGCCATCATGCtgcgcttcgcctcgcttcgTGTCgcaccatcatcatcatcttctcccTCGCCTGCAACCGATCCGAACCATACCAAC
CAACGcctctccatcgtcgtcctccccATTCCTGCTCCTCTTCACCTCTTCTCTAGGATTTCGAAGACCCGCGTGACGCTGACGATGCTATTCGCTCTAT
GGACGGCCGCGACTTCCTGGGTGGACGGTAAGAGCTGCGGGTTTACAGTGCTGTTTGGCTGCATCATAGCTGTCCTGACGCCTGGTGTGTCTTTCGGATT
TGTGCTTGACCAGGATTCGTGTTGAGCTCGCTCGTGGTGGCAGCCGCCGTGACGGCGGAGGCCGTGATGGCGGTGGCCGTGATGGCggtggccgtcgtgg
tgaCGATGACCGTGGTGGCTTCGgccgtggcggcggcgaccgTTTCGAACGTGGTAAGCTGAGCTGTGCTGTGTTGTTGTACAGTGACAAGGCTATTTAA
TCTAACGTTTGCTGTGCTGTTCCCATTAATGTAGGTCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTGATGTGGACT
GGCGCAACGTGAAGGACTTCCTGCGCACGGGTGGCGAGGTCACCTACTGCAACATTGAGGCTGATGGCTCGGCGTACGTACTTCTTATCGTCTGTTAGAT
GGAAACTTGAAGCAGTTTCTGACCTTATTCATGATTTCGACTTGTGTGCTTCAGCGTCGCGGAGTTCCAGACCAAGGATGACATGGAGGAcgccgtcaag
aagctggacgacacGGAGTTCCGTGGCAGCTATGTTCGCGTTGCCCCTGAGGGAGACTCGAGCCGCCGGTCGCGCTCTCGTTCTCCAGCCCGTGGCCGTT
CGCCGAGTCGTCGCTCGCGTTCGCGCTCGCCTGCTGCGCGTAAGGACTCCCCACGCCGTTCGCGCTCCAGATCAGCTTCgcctgccgctgccgctgccaa
cTCGCCCACCCCCCGCAAGGACTCGGCTTAAGCCGGTGTGGTTCGAAGAAACCTGGAGACCTGCACTGTGACCGTGTGGTGAGGATCAAGAGGGTCTTCG
CTCACGCAGAGGTTGACAGGTCGACCAGCTTTGTCTGTTGCCTAGCGTCGAAAGAAACAAGCACGTTAAACGATGGCAATAGCTTCCTGTCTTATCAGTT
TATATCTTGTAGTTTGATATCACGTGTGGAACTTCTTCACACCACAGCCTTTGCATTTCAAAACGATAGTTACTGGTAGCCAAAGCGTCCTGAATACTTG
GCGTTAACTCCACTGCGTTGACACTGCCACGATACTCGGCATTACATGGTTACATGTAGTCGAAACTGAGGCATAAATATCTGCGTACAGCGGTCCTGCA
GTCTGGTACTAAGTGGCGCCTGTAACGCACGGACGAGACCTGTAAACACGATGGCaatcaagaccaagaagcgaAGCAGAGGAACGAGACCGAACGATCC
CATCCGACAACAAAAGCAATAGACCTGCGGATGAAGGCGATGGGTGGTATTTGTGACTCCTCTGGTTTCCTTCTGCGTCCGTCCGTCCAACGACCGGAGT
AAAGAGGGAAGCTGTTACGAAAAGACACCCCTGCCGTGCCCTGCAGGCCAGTCTCCTGCTGATCTTCCTCTACAGCAGACCTACCACCTGCCCCCAACGC
TGAAAAAGCTTAAGAAGACCGAGCTTTATTATGCGCCGCACTTGCACGTTGCCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTGACATCATCAATAA
CAACATCCGGTCAGTCACGGCATTGCAGATATAAGAGCTTTAAGGCCGTGAGCTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGT
GTCCGTCACGCAAAGCGTGTACAGGTACTTGGAGCAGCGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTCACCGAGCGCGCATCTTTTCGG
CGAGCCTTCTGCAGGAAGTCGCGGATGTCGGTGATCTGCTTCGGCTGTGGGTGAATGGGCAAGGCAACACAACGCAAGTCGGTTGTTAGCtgtgtctgtc
tgtctgccTGTCTGTCTGTATCATCACCGCCCCTCAAAGAGGCAGGCACCACGCCTCCGTACCATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAG
CACTAGCAGAGTCCACAGCAGGGCGCTTTGCTGGCCAACCAAAAGGTGGCAGACCCCAGTGCCAGCTTTCCATCCGAACTTTTTACGATACTAACGCGTA
ATTACGTCTTCATGTGGTACACACCACTATGTCAAGGTTGTGTCAGAATTGTTGTCCTCTGAGCAGTCTGCTACACTTGGATTCAGTATGTCAGCTGGTT
ATTTCAGTCGGAAAACGCCGCAGCGCTAAGCTTCTCGCGGCCCATGGCGTCGAACCAGGAGTGCCACATCTGcctggaggagctgcgtcgcgaCCTGGTG
ACTGCGCCGTGCGGCCACGTCTTCCACCACGGCTGCATCCTCCAGGCGCTTCAGGTCAACACACAATGCCCCAtctgccgccgccgcacgGGCGACGCGG
ACCTCATCACGCTCTACTTCGATGTGCCGAGCGTTAACGAAGCACCAGGCGGCAAAGAGCAGGATCTGACGCCCGTACAGGCCTCAGGAGACAGCTTTGC
ACTCAGCTCCCGTGTCAACACACTCATGGAGCGCATCCAGTGgcagaacaagcagcaggagcgacTTGTGGACGAGCTACGACGTCTCCGCAGTcagagc
gagcagctcctggcgGACAAGCAGATGCTGGCTCAGCGTCTGGGAGGATTGCAAGCCGCGAAGATAGAGCTACTGACTAAAGTGGCGAGGTACCAGATGG
AACTCACGCGTCAAAcagaagctgcacgcagGTCGAGTGTGAACCAGAGCATCATTAACTACTTGGAGACGTGTGACGCGTCTGCAATGGAAGAGGAGAT
ACAGAACCCGAGAGAACTTATTATGGCACTGAAAAAGGCCTGCAAGTTCCGTCATGATCAGTATcagaaggtggtgaaggagaaaATGCGACTAAAAGAG
ATGTTGACAAATTCGCAGTCTCAACCTGCACCGCAACAGACAACGAGTAATGCAAGAGCAGCCAAGACCAAGGTTcgagcagcgtcggcagcgtTTGAGA
GCAAGCGTGCTTATCCGACGCCAGGGACGTTTGGAACGGGAATTCAGCCGCAGGTcgtggagaacaagaagcggaaaatcgactcgtcgtccatggcaTC
GAACCCGATGCCGTTTTTCGAGCAGCAGGGTGACGATGGCGGTTTATTTACTCCACGTTCGGAATCGGCGGGCTTCCGCGCGAACGCCTACTCGGACGTG
TCGATCCGCCCACCTCCGAGCTCACGGCAAGCATTTGGACGCAGCAACTTTAACCCGAACCAGTACGGAGCTTTCAGCTTGACGCCGTCTAGTCAACCAC
CGATACAGATGACGGCACCCCAGGCCGCTGTGTGTCGTCGTGGCTACGACGAAACCGGTAAGCTCACCAACTTTTTCCTACCAAAGGAGGGTGATTCGCG
GTCCGTGCCTCGGAAGAAACCGATTCCGAGCATGCAGAACCTGCTGAACTCACAACCAAGAACTTCGGGTCAGCAACAGCGCGTGGCGAGCAACGACCGA
CAGGAGTACGCACTAACAAACTGGCTGCGCAATAATTAAAAGGGCCTAGGAAAGCTGATGTGTAGACCTCAGAGGACTAGAATTTGCAGTCAGGACATTG
TGTAAGATACTATTTGCAATGGTGCGGCTGGCACGGCTATCGTGTCTGCCCTTAAACTTAAGAGGTGGGATATTTGCTTGACGTGCTTTGATTGTCTACA
GCTTTCCGTGGGAGCCGTGAAGTTGGAAATGGAGATGTGTCAGCGTTTCCTGCAACATGACTTGGTGCTCTTTTACAACCTGGATGACCTGAGCATCATT
ACTGGGGAAGTTCTTGTCGGGAATGAGACGACGCCCAATTTCGTCGATGGACAGAAAAGAAATGTCTGCACTGTGTTCCTCTTCTTGTGGTTCAGGGGGA
GTAAGTGCTGGGTCGATACCGTTTGGGTTCTGACTTGAGCTTTCATCTCGCTCACGATTTTTATCGCATGTATTCGAATGCGTGGTTGCTATCGTTTTTG
ATCGCCGTCTTGCGAGGAATGAGGTCTCTGGAGAATCCGCGGGTGGTGGCAATGGAGATAGTTGTCTGCAGACACAGTAGAGAAGCGTAGCCAAGCTGGC
CAAATTTGCTGAAGCCTGCTTACCAATATTCTTGGATCCGATGCCTACGTTCCAAGGCTGCAAAATAACATGAGGGATCAAGATCCTGACGAGCAGAAAA
TTGATCACCACTACGTTGAAACGCGAAAAATCGCTGGAAGCCGACACCCCGCTATGGTTGTTCTCAACTTCGTCGACAAGATTAGCTCCGTCAAAATCCA
TTCTACGAGTAGCTCCAAGAGCGTCGAATTCGAGATGTTGCCGTTCGTCGTCGAATAATTGATACTGTTGCAAGGCGAACAAATAACACGTCAATCTAGA
TAAATACGTAAAACAACAACAGAACGTTCAGCGTACACTGGGCGGAAAGTAAACGCCGTCGTTAGAAATCCGCTTCCAGAAGTCCAAAATGCCAGATGGC
ACCTCATTCTTATTGATCGCCTTGCCCAGAGCTTGCAAAATTCCTCTCATTCGCACTTTCAGCTTTAACAGCTTGACTGGATCCACAGCACTATCCTTTG
ACTGTCCGACTGTCGCTGGTGGAGTATGGCGACGAGCAAGGATGTCGCCAAATTTCTTAGTGAAACCTCGCAAACTTGACCCCGCAAGGCCACTTTTCTT
GCTAATATCCACGTCTAAACTTGAATCCTGAAGTACAGAAAGCAACGGTGTTCTTACCACTTTTCCTAGCCACATGCGAGTAGCATCAAAATACACACGT
AGCATCGCCTCAAAATCCTGAGCAGATTTTGTTAGTGGTAGAGCGAGGTATCCAAAAATCAAGAACCACAACGTACCCGCATCGCGCTTTCCTTTTCTGC
CAACTTCTTTGCCATCAACAATTTCTGTAGATGCACAGTGTGCAGGACCGCTAGTACGGCCGACCGAAATATGTGAAGAGGCTCCATTGCCTCCGTATCC
TGGATCTCGAAGGGTGATACATCGTCGCTTTCAGCCTCAGCTTCAAGACGCCAACGTGGTTTTCGCAGAGCACCACCGCTTGCATTTTTAAGAGACGCGC
TTAGTAGTGCCTCCAATTTTTTTCGGCTCTCGAGACGGTCGTGTGCTTTCTGCTCCTTCGGTGCGTCAGATTTAGAGCTGTCTACCTTGACAACTTCGTT
TCCCTTGGCAATGTTATTGGTATCTCCAACACCACTTCCTGGTATTTCTTCGTCATTCTCGAGTTTGTCAAGCGCCTGAGCAACATAGTTTGAGCGATAA
ACAGCGAATTGTTGCAACTCAGTCACGTCAACTTGATCAATACGTACCATTTCATCTTCGTCTGTCCATTCGAATTCAGGAAGCCACGACAGTGCACTTG
GAACTGGGAAAGCTGGTTTCCTAATCGGCGCTTCACTGTGCGTCGCTGGTTCTGCAGAGATATGTTGTTGTTCCTCGTCAGTGTTTCGCACTGATAAATG
TTGGATACTACCATTGGCCTTGCTGGGGGCCATTAAGGGAAGTGGTGGGTTGTCAACTACTTCCCGTGCTTTGAGCTTCAATTTACTGTCTGAGCTGTCC
AAAGCATATGCATCTTCGCTTCAGTACAGTACAAGAAGCCGCAGCACCAGTCACACAAAAAGTAAGCTTTTCATGGCGGAATCTGTGTAGCGAAGCAGTT
AGGGACAATACCTACTGTCTCCGGGGAAGTAGGAGTGCCATAATCTGCTCATTTTGCTGTACCAGTCTCTCAATCATACTTTCACAAGACCCCTGCTCCA
GTTGCACCGAGCCATTCATGCCATCAAAACTGATCCGTGAGTTGTTGCTATGCGCAGGACCAACGCTTGCTGAACTAGATGTCTTGAGCTAGGAGCAATT
CAGTGTACGTCTAGGTGAGTACATACATATGCATTGCATTATCAAAAACATGCTATATCTTTCCAATCTGAACGCACCTCGTAGTGGAAAGCCTGTTGCT
CAAGTCGCTGCACTTGAGCTCTGTAAAACATGTCACTCAATTTACATCTCAACTTCGGATCGATATCGCCACAGGAATTGCTCGATACCTCAGTTCCTCC
CGGTGTTCTCTCCGAGCCTCtatttgttgctgctgacgcatTCGCAACAATTCATTCTTCACCGCCTCTTGACGAAGTGAGAGTGTCACGCGTTGCGCCT
CCGCTCCTCTGAATTGGTGCAGTGAGTACGGATCACCCCATCGCCATGGCTCTGAGTGCTGCATGCCCACGACTTGATATCGGAAATTGAAAGTCTTTTT
TTGGCTGGAACAGAATACCATCCACTCAGTAACATCACAATCTGAGTGACAGGAACGATGAAATTCATGTATTCCTCCGCTGTAAATGCTTCCTGATCAG
CTCTCTGCTGTCACTTGGTCCTGCTCTTCGACAGTtttgccagcagcaggggTAGCTTCCTGGGCATTTTTGTCCTCAGCATCCTGTTCTGCAATCTCCT
TTTttgccgcttcttctcgtccgagGAAGTCGTTCGTCAAAGACTGCTGGAGATCCTCAATTTCATGGAAGAGCTCGAGCGATTTCTCGAGGATTTGCGT
GGCAGACTCAAGCGCGTTCTTTGATGCCGCCAGAGTCATGTTAGTAAACAGTGTGCTTGCTGTAAGTGTCCCCTCCGTCATCGTGGTCTGGACACCGCGG
ATCTAGATACACAATTGAACAAAGAGTTAGATATAGCAGCCCACCAATTTTTGCGTTGCGCCCATTCTTGTGTTACCTGATCCGACAAATCTCGCACTCG
CTTTGATATATCCCCGTAGCGACACTTCATCTTGCCGCAGATCACTGGCAAGGACGCCTCCGCATCACTAATGTCCACCACACCGGGTGTATGAATCCCT
TGTCCTGCAACACGGACTTCCTCCGGAACGTAGATAAGCAGTGACGCCTTGAACGTACACATGCCTGTTTTCTTCAGCCCGTACAGTTTTGTGTCTGATT
CCGGGTTACTGGAAGGAATAAGTTCCACAGTCATGGAATAGTGATCGTCGTCCATGCAttcgtcaccgtcgtcgtaGATCATGTACTTGTAGTTCAACGT
GATAGGATCGATGTGCCAGCCGCGGAAAATGCTGCAAATGCGGCAAGCGCCACACAAACCACGTCAGCAATTCCCAACCCAGGCTTCTACGATAGTCAAG
CATAACTTACCCAAGGATAGTGGGGATTTCCGGCTCCTCTTTCTCTTCGGATACTGGTTCATCTAGCTCCGCAGTAACATCAACTTCATCCTCCATCGCG
TTGGGAGGTTCCGACACGCCACCAGTCGCTTCCACCTCCACTTcttccaccttctcctcgatcttAGCTTCAATTGTTACGTTTGCTAGGAGACACAAGT
CCAGAATATAGCTGCAATAGCGTTTGGTAAGCTCGAGTCCATAAGAGGAAAAATGATGGGAAAAGCATTGAACACTCACGCTTTGCCTGGCTGCATCTCT
CTCTCCTCACAAACGCACGGCAGTGATTCGAAGTTATCGACAAATGGACCTGCAACCCACAATAGGAGCACATAGTCAAATTTACTGTAGATATTTCACA
ATATATAATTCGTCACAACTTGCCTTGGAATGCTGCGAGTGGATCGCGGGACGGGATGGGGATCAGCACCGGCGCCACCTCTTCTTCCGGTCGCGGACGA
GGGATGACCCGGATGTCAACCTTAGGGGCAGCCGCGCATAGTGCGCTGCTCAGCGCCACGGCGACTACCGCGCCGGCGAACACATTCCTGCCCCTCATAC
TGTACTTGCGTCAATTACAATAATGTGTTCTCATAGGTTTTGCATGTTTGAATTGGATTTACAATATATAAATTATTTTGTTTCGCAGTATTTATAACAA
ATGACAGGGATTTCAAAGTTGAAGtaagagtgatggtcaaaTTGCGCGCGCGCAATGGCGGATTTCGCCACGTAAAGAGCAAGCGACCGAGCGAAGATGC
AGGATGAAGGCGAGTCGACGATACTGAAGCGcgtggagaaggctgcggGGCTTCTCTCTCGTGCAGGAGAAGCGTCGCGTGAGTGGCACCACATTTCCGC
GGCGGATGTCGAGGCCTTAAACCaagtgctggatgaactTCAACGCGCTATCACAAGTTTCGGCTCGCAGCGTGTGCTGGAGCTATCGGGGACACACCTT
ATGAACGCTGGAGTGGAGTTATACAACgcgccacgagctgctttAAGAGTTCTGGcgcaggtggagaagaccaagaagcaaGGGGATGAACAACCTAAGA
GCTTCTCCCGATATGTACTGGCACTCACGCGGTTTGTGGCTGCGAAGGTCATGAGACTGTCGCTGGTTTGCTCTAGAGATGGTGGGGCCCAGGAGGAAGG
CGAGCAAAAGAGAATGCAGTTCATGGACGAGTGCGTCGACGTGCTACGCTCGTATGGTCGAGTGGGAATGCTCATGTTGGAGAGCGCATCGTTTGACTGC
GAAAAGTGTGAAGCATATTTGGCGCTGGCAAAGGAgtcgttttcttcttcaatgcAGCTTTGGTCTCGCATCGGTCTCTCCCATCTGACGAAGTTCAAGC
AAGGCTTGGAGCTTGAGGACATTGTGGATGATTTGTGGGACTTCTGCGTGGACCGAGTGCGAGTGCTTCGGTTGCTTGCAGAGCGTTCTGACAATTCATC
AGAAGAATTTCGAGATAttgtgtcgtcgctgcatgAGTTGAAGATGCTGGCCCCATACAAGCTTTCGTATGCAAGCAGCTTGCTAGATCTTATGACGAGT
GTGAGCGATGGATACAGTAAAGCAGCccaccacgagctgcaagttTCTTTCGCAGAAGAAGCGTTGCGAGTCAGTGACTCGCTTGAgaatgatgaagatg
aaagcTTTCCGGAGCTGGTTACCTCGTTCAAGCAGCACGTGTTGATaaatttgctgcagtctctTTGCTCAACCGGAGATATTGAGCGAGCAGAAACGTG
CTACCAACTCATTCCAGCTAATCGAGAGCCCAAAGTATTGCTGCTCATGATCAAGATCTACGTCGAAAACAAGCAGTTTGATAAAGCGCGTCGCTTGATT
CTGCTGTTGTTTGAACAGGATAGCCTTGACGACTCCATTTTAGCAGCCCGCACCTACGCCCAGGGTTTATCGTTCTCCGACAAAGGATTGGACGTTTATC
GAGTGCTAACCGACAACTACAGGGATGCCGAATTCGCCATCAATTTGGATATCGCAAGCAACCTCGCTTTTGATGAGAGCAAACGATATCAAGCTATGGA
CGAGCTTAAACGTATTGGGTGTGCTCTGCTGGAACAGGAACAGTACGTATCCACTGATTGTTCGATGTGACATTGGCCCTTATTCAACAGTGTTTGCTAC
AGGGGCGGCCAAGCTGTCGACACTAGACACATACTGCGAGTTCGACAGACCATTTTTGATGCTCTTCAGCATGCACTGAATTCTAACCAGCACGAGGTAT
CTTGCACTTTGGCTGGCCGTGCGGGCGTTGGAGCGTGGTAATACTAACTCACTTGACACATTGTAGGACTGCTTGAAATGGGCAGATGCCGGTTTGGCTA
CGGCTTCAACAACACAAGATAAAACAACATACATGAGGTAATGACGACTTTAGCCGTGCATTTACAAGCAAGTAATATTGACCAGTTACTCTCTGCAGGA
CCATGTCTCGCTCGTGTCTCCAGTTGGGCCGCGATTCTGAAGCTTTGGAGTGGGCTGAGAAggcttttgctgcagatcTTTCCAAACAATCTCTGTTTGC
TGTATTCCAAGTAGCACTTGAAGCAAAACCGGAAACCACAGAAGAAAGGCTGGTGCatctcatgcagcagctaaAAGCCAGAGACGATTTCGAGATTGAA
GACTTGCTCGCAATGGGAAAGCTAGCTAGCAATCTTGGTCCATCGAGACAAGATTTTGTGATGCACGTTCTGGATGAACTTTGTCGTAGTCTGTTGCAAG
CCGACGACCGCCCGACAAAGATCCCCATAGCAGTAGTCCTGCAAAATGCAGCTCAACTCGCATTCAGCAAGTTcactcagcagcatcagTCAAGCGATAA
TTCAGAAAGCTCGTACGGAGAGAAATTCCTGGCATACGCCAGCGCGCTGTTGCAGTCATCAAGACCTGACAGCGTCGATCAAAACGGCAATTTAGGACCT
TCTTCAGTTTTCGAGTGGTTCTTTCGGATGAGGTAAGAGCTCATCACCTGTTTTTCTTGCAGACTCTGATAATTGCTATTTGATCTTGCCAACAGCTTTG
ACATCGCCAAAAGCACGGAAGACTCCAGATATTTTATCGTGGCAGCTAACATCGCAGAACGGAGCAACGAGCTCTATGGGGAAGCATCCTCACTCAAGGA
GCGATGCCAGCAATGTTTGTTGGCTGCAGTGAGTTCTGACATAAAGAAAATCGAGACTTTGGACAAGAGCCAGCTTttggagcttcttgaagcgaTCGAC
CGACTCGGAAGTATCGATTGTGGAGATATTTCTGTCGCTGCCGACGTCGTGTGCTATTTGGTACGAAGCACCTGATGCGTGTAACAAGAGGAATGATTTT
CACTCACATTGTTTGTCTGCTGGCAGGCGAGGGCAGTGATAGTGGTGAAATTGCGGCTCTTCGACTCAAATACAAAAGCGATTCATGATCTGTGCATGGC
CACATTTCGTAGTGCTCCTGAGCTCATGGAGATTGGAGGTGTGCCGTGTCAAGATAATCGCTGAGCTTCGTGCTTTCACTCACGTATGCGTTGTCCTGTA
GAGCTAGTGATGTACGCGTCAAAGTTCAACGAAGCGTCTGAGGTAAGAATTGTTCGGGCAGGTACAGTACAACTACCAGTCTCACATCACTTGTTTGAGC
AGGTTCGAGACAGCTATCGTTATTTAGCCCGAGAAATATTTAACTATGGGTACAGTATGAGCTATGAAGCGCTTATTAACGATAAGCACACTCGTCCACT
CGTCCACACATCTAACATATCTATAATGTGGAGGCTTCAAATGCTGGTCCAAGCGGACTCAATCGACTCGAGCAAACTGTGTTATCTGCTTCGACGGCTT
ATTACGCTGGCGGAATCGAAGACAAAGGCACACGAGTGCTTTACGCAACTACTTCAGTTCATTTACAATTTGGACGTGACGATTTCTGAGCTCGACACGG
AGTGGTTCGTCGCGAAAGCGTGGAACATCGTAAGTACACATCATCATCGCTTCAAGCTCAAAACTCTTGTTGGATCTACTAACTGAAGCGCATTTAGGGT
GTGTTATGCCATCGCGGAAATGATACTGAAGAAGCCCTCAAGTTTATGAAAATTGCTCAGGATATAATGCGTAAGTgtattacttcgaagtactgtaGTA
CATACATGAAAAGCTCGCGTCATTCAGCTTTCTAAATCTTGCCTATGGGCTGTGTGTAGAACGCAGTGAACCGATCATGGAAAAGCTGGGCAATGGGCTC
GACCAGCAGTACCAGGCGCTTCTAAGAATGAGCACCAGCTCGACACTCGACGGTTAAACAGTGGACAGTAGCTAACTTCGAGGTCAAAACAGATGCGATT
TTATTTGATTCAAACACAAAACAGAATTTATGCCTCGTACACATCAGGTTGAGTGCCGTGGCTGGATAGCCCGACTGTGTGCGTTTTCACAGCCTCCATG
TAGGTTCGCAACGTCGGCAGTTCTGTcgtctcttccttcttcagTACCTTCGAGGCCCACTTTCGCTCTGCATATTCACAAATCTATACGGCCAGCCAGA
AATACGCAAGCTGTAAGGCTACCATACCACGCTGAAGTTGAGCACTCGGAAGTTGCAAACCTACCTCTTTGATATCTCGGCACGAAAGTTGCGGTGAAAC
AGCGGCCAGCTGCGCGAGTGCTTCGTCTGATAACTGTTTAGCATACCTAGGAGGGGAAATGGCACGTCAATGCACAGCACATCAGCCCTCACGCTTTGCC
CAGCTATTTCTTTTTGCAGCAAATTACCGAGCAAACACTGCGCGGCGGGTCTTCTCGTCAGGGAGGTTGTAGCGGATTGAAAGATCGAAACGGCTGATCA
ATGCGGCATCCAAATCCTGCTTCCTAcaaacatcaacaacatgcaCTCAGAGTTTAGCAATCTCCGATGGTGATATGTACAACTTGCAAAACCAAGAAAT
GTACCGGTTCGTAGCGCACACGACGgtggtcttcttggcagAGGCAAATCCTTCCACCTTTTGCAGTAGAACTGACAAAATTCTTCGCGAAGCTTCGTGC
ATTGTGCCACCAGAGCGATCTCCGGCAAGTGCGTCAATCTACCACATACAAAACATACAGAATCAGCACCAAACCAGCAATCCACTGGACAAACATTAGC
GATAACACACCTCGTCAATGAAAATAATGGCGCCATCCAGTTTCTCGCACGCATCAAAGATTGCCGACATTTTCTTCTCACTGTCACCATACCACTTGGA
TACCACACTCTCGATCGGAATGTGGATCATGGGAATCCCTGCCTGCTGTGCAATGATTCGTGCACTTAACGTCTTGCCAGTACCTGGAGGACCTTCAAAA
AGCACGGCACGAGGGCGATTGCTCTCGTAGCGGCAACGGGTTTTCTGTGCAATACGCTCATAAAGCTCAGGATTCTGAAGCGCCAGCACGACAGTGTCTT
CAATCTCCAGTTTTACGTTCCCATACCCAGCCTACATATTACGAGACAAACCAACCGCAACGCAGGGTAAGCTCACAATGCCCACCTGCTTGACGTCTAA
CAACTAGCACGTACCAGACTATCCCAGGTCAAGCTGTTTTCGTTCTGAGTTGGCTCAAACACGTCAATTCCAAGGCCTTGTAGCTGTTGGATCGCCTCTT
CCTGCAGCCATATTGCATACGTAAAATTCTTATCACGATAAAAGAATTATAAAAGGCACAACAAAAACGAACCTTGCTatcaggtgctgctgccgcagtA
GCAGTAGTTGGATTTCTACCACGTCCAACGAGCGCGTTCTTacggcgctgctcaagatcGTGTCGGAAGAACGCGTTCACATTTGCGTACGAATAAATCT
CCTTGTAGGCACCGACGACAGCATCGATCTCGTCTTGCGTCAGGAACTCATCTTTATAGAAAACGAACTTCGACGTCGCTTGCAGCGAAGCCGTATCACG
CAAGAACTGGAAGGAGCCAGAGCCGTTCGCGTACAAGTACGTCACAGCAGGTTGTTCGTTGGACTCCACAACAGACTTCTTCCTGGTGTTGTCCAGCGGA
ACCGGCAGCACCTCGACAGCCTGACGAGAACCAGGCACCGACGTCttctgcaactgcagcaggaaacGTCCAAGGATCGCCTCCTGATCGACGAACGACG
GGCAGGCAAACTCAATCCGGATCGTCGACACGCCATTAGGCGCATGAATCCTTGAAATGCCAATCTTCTTGATAGGAAAAGCCTTGGGGATCCGCGTCTC
GGAGCTCTTGAGAGTAGTACGGAACTCCGACACTTGCTGGCGGATTGTATCCACCGCTTCAGCGTACTCAAAATGCTacaaccacagcaacacaGCATCA
TTTAACCATGTGCCACAACATCACTAAAATCTTAACGACAAGCGTAGAACCTTTTCCTGTTTCTTGTCCGGAGGCGCCTCCGATTGCGCTGCATCGACAG
CCAGTCCACCCGCTCCAGCGAGGGCTGCAGCCCCAGCAAGAGCTGCGAATCTGTTGGGCGCAGAGTCGCTGGAGTTTTCTGCAGCGACAGTCAAAGTCCG
CAGAGCTTGGCTGGTCTGTGCTGAGGTCGCAGCTGCGTTGCGAGACAGAGAGACCTCCAGAGACACCGGAAGGTGAGTGAACTGTCCCttagttgctgct
gcggcgcgTGATAGAAGCTTGACGGCAAGTCCACACTGCATCATCGTCTTGAATTCCGTCGAGCACTTCTCGAATGACGGTTTCGATGGGATTGAACTTG
TGAAGTAGTGATTAAGTGGCTATATGGGAGTACGTATTAAGTAACATGGCCTACTTCAATCTGCATCGCATCGCGATCGTCCAAGCAAATCTCTATTTGC
ATTATCTCGTTACATGCTAGATGGTGGTGAATAAGCGATCTCGCCGCAGTGAACGAGGTCCATCTCAATATGAGCCAACAAATGGCTGTCTAGCGACCGC
CGCGCACAAATACTTTTTTGGGTGGCGTCTCGGCTgctttctcctcttcgccTTCACAGCGCTGGCGGAAGGTAGCGAGCTGCCGTCTAAGAGTATTGAT
CGTCTGGGCCTTCTGGGCAAGAATCTGACACAAGGAAACAAGAGACGTTAGATTTGTTGTCGTCAAAACCTAGACAATATAGCACGACGAAAACCCACCT
CTTCCAGACGCGAAACATACTGCTCAATACTCGCTGACTCGTCGCTTTGAATCGTTGCTAGCATAGCTCCTTCCTCTGTTAGAAGCTCTGCATTCTCCTA
TATTATATTGCGATGGGCAGTACGAATTAGACACAAAAACAGATTTAGCAGCTTTGTTTGGTAGGGCAAACCTGAATTGCACTCATGTGCGTATTGAACA
AGCCCTCTTGCTCTTCATACAACGTTTGAACCTGTCATTAGTAATCAAGCGCAAGAACCCACAGGCGTTTAGTTAGTTTTGTGTTTGATGTGATGTATCA
AATAACCACCAAGCTGAGCCATTACCACCCCTTGCCACGCTTCTTCAGGGTACTCGCTTTCCTGGACAGGATCACCACTCCTTTTATCTGATGACattga
cagcagcagacaatAGTTAACATTCAGGGTTATCCGTAGAGCAGCCCTTTCAACGTACTGGAATGACGTCGAAGACTAAGGCTGAGAACGCTTAAGTCGT
CACTTAAACCAGGACCCCCGCGTGTTTGGTGCGACGAATTCGTCACTacatcgttgctgctatcATCAGCATCGCCCCTATACTTTTCCCCATTGCCTTC
AAGCATCgggtcatcttcgtcatcttcttctccaagcgGATactcctcttcgtcatcataCTCTTCGGCATCGTGGCCCTCATCGTGTGCAGCATACGCC
TCGTCACCGTCAAGATCTAATTCCACGGTAAACGTTACTCAACATTCAGCGCTTACCAAAGTCAGTACCAAATCACACACCCTAATACATACCCTCTTCA
AATTGGACATCCTCGACGTCCACCGCGTCAGACTCTGCATTTCTCTCGTCAAATGCATCTGCAGAAACACGCTTCTCTTTGACTCGATCAGCGTATCGAA
GAGTATTGAGCGTATGgtccgaggacgaggcaCACGGGGACACCGCAGCAATCATCACCGTTCTACCCGTGGAGCGAACAAAATCCAAATAAGTAGATGG
ATCAATTAATATCGTTTATCGCAGTGAGTGCGCACCTCGCTTTGGCGTTGACAAACGAATCTTTTAGTACTTGGGTGAGCTTGCTTGCTCGGAAAGGGAT
ATGAGTTCCTCGGCCGCCACTGTCCAGCGCCCTACATAATAAATCGATGAACATGGTCATAAACAGCTTGCACATACCCGCAACATAATTACATAAATGT
CTGGTTTGTATCATCTAATACATACCGGAAGCACTCCTTCAGAGCCAGCAAGCTCCGGTTGATTTCCGCCGACTCCATTCGTCGCTGCCGATTGTGATTC
TTTGTGTCTTCACCACGTTCACTGCCAGCAAGATCGATCAAAGACATTTTGCCATGAAGTCGTCCCGTTCCTTTTTCGCGAAGGTTGATCTGGCAGATGC
AGTGCGAGCGCGACGACACATCATTCACCTCCGTAGCATGCGTCGTGCGGAGACTGTTGCCTTTGCTGAtcacttgcagcagttctTCCGTATTCTGCGG
TTGCACCTCCTCCAAATCCACAATCTGCACctctccagcgccatcttCCCGAATAGTCAGCACctgtcgatgcagcaggtCCTGACAGCGTCCACCATAg
atctcgaagaagctcacaCAAATATCCAACGGATACCCGCGTCTCGCGAACTCGTCGGCCTGTGCGAACACATCTGCAGCAATTTGACTCTGGATACCTT
GCATCGTGTGCGTCTTGCCACTGCCCGTCTGTCCGTACGCAAAGACCGTAGCATGGCCGCCATCATGGAAAACAAACTTGACCAGCGGCTGAgcagtgta
catgtacacactCGTATTGGTCGCGTTCTCATCAAAACTCTACAGTGTAAGTTAGAATCAACCACCACATCAGTCCACAACGTCCATATCTGTTCAAACt
caaatgtagccatccCCTACATGATCAAAGttgaaggcgttgctgtCCAGGTACTTGGTGATGCCGTCCACCTTGAGCTTGCAGTCGTGCACGATGGCCA
TGGGGTTGAGACACGTCACAGCGTCGTAGTCGTGTTTCTTGACCTCTTTGGCGTTCACTGGCCGCTTGCGCACGCAGATGGTGATCTTCGTGTCACCCGC
CTCCGCGTGTGGTctgttcttgtccttgttctGCTCCCGGAACGCCTTGATCATACGCTGAAAGTCCACGTCGCCCGGGTGCCCCAATTTCTCGTTCAGC
TGACTCTCccgctcgcgctcgcgcttggccgccgccatggcGCGTCGTCGGTCCTCGCGGTTCTTCTCGATCTCTGCAATGGCCTGCATGGTCGGCTTGG
CGCGCGGCGTCATAGATGGCAGCccgcggccgccgccacctcgcGCATTAATACTCGCTCGACGCGCCATCCGACGTCCGTTGGTAGAAAAATTATCCCA
GATTTGGATTAGAGGTAGGCACTTCAATTTGACAAGAGAAATATTTTAGAAATGGAATTACAAATCGTAATTGAAAAATAGCAATAATAATTGATTCTAT
ACAGTACATTTAAATAAATTATTGTATTAATAACGTTAATGAGCTTCTCAATCGTTCTGTAAAACATGGCACGACAGGAAACCGAGTCGGCGCAGATCGA
GGAGGCCATCGCTGCCGTGCAGAGCGGCTCCATGTCTCTACGGGAGGCTGCGCGCAAGTTCGACGTACCCCGCACCACGTTGCAGCGTCGGGTGCAGCGT
CGTGCGTCGGAAGCTTCGGGTTCTGCCGTCTCCGAGGCAGAGGCAATCAAGCAAGAGCCGGCCACTCCTGCCGCCGTTGATACCAACGCTCAGAGCGATA
CAAGCAGCGAAGACACTGCAGAATGTTATGGAGCGGAACATCAGGCGACTACTATTATCGGTCACAAGCGATCTGCGAGTCATCTGGAGTCGCCCAGCCA
AGGTGAACAGACAACCATATTGAAGTGGACTGAAATAGTGTATTGACCGGGTTTTGGAGCGTGTTTTAGGGCCGCGGAAGGTCATCAACTGCAAGATTCG
GATGCTGTGCACAGCGGCAGGGAGCGCGTTGGATGAGTTGAGCAACAAGATGATTAGGGAGGGCAAGTGCATCTACAAATTGGGATTGGGTCAGTCGCCG
TTTCCGATCCCGCAGTGCATTGTCGACGAACTACGGTGAGCATCTTGCTGGATTGGGGCCTTGTTAATCTGTACGAGTTGGAAGCTGATTGTATTTGTTT
TTTTGGTATTTTGATGCAGTACCAATTCGCACCAGAGAGACTATTTACCTGTTGCGGGGCTGCCAGAGCTTTGTGATGACATTGCTGCGTGGGGGACGGA
CCGGCTGCACATCAACTACTCGCGAGACGATGTTTTGGTGGGCCCTGGAACCAAagagctgctgtttgtgctgcagacggTGTATTATGGAgatttgctg
ctgcccaacCCGAGTTGTACGAGTTACGCTCCACAGGCCGCTATTGCTGGAAGGTACCTACCTGCGTGGATGGTTCATTCCCAAACTGTTTGGGCTTGTG
AACAGAGATTTAATTGTGCTCTATTGTGCGCAAAGAAATATGATGTGGCTGCCCACCCATGCCGAAGACCACTTCGTGCTTCGTCCAGAAGTACTCGAAG
CGCATTGCGTCAAAGACCCAGGTACATGCTGTTGAGACTGATCTCACCTCTTAACGTGACTCGTGCTTTGCTCACATTGCGTCGTTATTGCTGGGATTCT
GTCTTCAGATGCTCCTCGGATTCTCATTCTAAACAGCCCTTCAAACCCCACTGGTTGCGCTTACCAGGCCGATGAGGTTTGTGGTGTTTACATTGTTTCA
AAAAGAGTGAAGGCGAGGAATAACGCTGTTTATCGTGCTGTTCGGAACGATCATCGCTTACCAGCTGGAGGCACTTGCAAAAGTCGCAAGGAAATACCGG
ATCCTCGTCGTCTCGGACGAAATCTACTCGGAACTGCATCATTCTGGAACGCATTTGTCGCTTTCCAAGTACTACCCGGAAGGGACCATCGTTTCAGGGG
GATTGAGCAAATGgtgcggcgctggtggctggCGCATGGGCTTTTGGTTGTTCCCGTCCAGCATGGACTggttgcgcagcagcatgctcGTCATGGCGTC
CGAAACGTACACGTCAGTTGCTTCGCCTATCCAGCATGCCGCTCGACGAGCGTTCGTTCTCCAGTACGTAGCACGATCCATCATACTCGCGAGCAGGCAA
CGCCAAAAATCGATCTAAACTAACGTCTCACCTTCCTCTGATTTTCTGCTCTCTGCTCTGTGCAGTTGCGTCGAGCTCGCCTCATACAAGCGCAAGTGcc
agaagacgctgaagctcATCGGTCGATGGTTCGCCTaccagctgcagaagatggacgTCGAGGTACAGGTCCCTGAGGCCGGCTTCTATCTGTTCCCGTG
CTTCCGACGACACCGCAAGGCGCTCGCATTGAGAGGCATCGCGACTGACGAGCAGCTGTGCGCACAGCTGTTGCAGGATACGGGCGTGGCAATCTTGCCG
GGTTCTGCCTTCGGGCGTGCATCGGAGGAGCTCTTCGCGCGGCTGGCGTTCGTTGACTTCAAGGGCGACCTCGCGCTCTACCTCATCGAGAGCATGGTAA
TCTTTTTCCTGGCGCAAGTGAGCCCATGCCACTGAAACGCTGAcctcactcactcactctATCCTTCTGCATTTTGCAGCAAGACGACCCGTCTCTGGAG
GCTATCGAAGGCTTCATTCAGTCGGTCTGCCCAAATCTTGACATCGCCATGCGCAAGCTGGCGGCATGGATGGCTCTTGCTCGGCCGTCTGCCGCGCCAG
CAACGGCCAGCGCTTCAGGCGCCGCCTTCTAGCTGTAGATAAACTGGTGCTCGGTcgcctcgccgttgccaacTAACTGCCTCGGCGCACGAACGGAGCC
GGATTTTTCCGCGGGTGCAGCAAGCGTCCTGCAAGCTGCGCAAAGTGCCAAATTGGCACAAGCGGGCGCAATGGATCAGAGAGAGACCACTGACGTCACT
CAGCGTGAAACTGCAGCCAAATCCCCGGTGACCTTCACGTGACGCGCCGCCGTTTCTTGTCAAACGATCTTATTCGCACGACCACGCCGAGCAGCATTGC
AGCATGGGTGGACCTGGCTGGTGCTTGCAATGGCAGCCCTATgcattgcattgctgcaTGATGCAAGTGAAGCCCGCTGAATTGAAATGAGTTGGTGCCA
GTGATGCCACATTGTCGTGGGCTGACAACTTCTACATTTGCGCCGTTCGGCTGATTTATGGCGAGAAAGCGCTGTCACTGGTGCGTCGCTGTCATTCCGT
CCAAGTTGGAAGAAGCCCTCCATCAAAAACCAGCATCCAAGTCATCCTTAGTTAGAGCGAGCAAGATGGCTCGAGGTCGTTTCGTCCGGAATGTTGATTA
TTCCATCTCGAGGGCGAACATTGCAGATACGCAAGAGTCAGCAACACTTCTTTGTAACGGAATCAACTTCCGCCCAGTATTCCATACTCTCTCCAACTCA
CTTCTTAACGTGAAATTCACGCTTCACTCGCACAAAGCGACGAAGGGACAAACCCGTTCCCCCCTCTGCACCCGAaaggaggcagcagcgagccgccgac
aacaacaacaacaacaggaACAGACTGACCGACAGACCGACACTCTACGTCTGGACGCAGCTTCGTGTGTGTATTCGATGCCTGCGGTCGACGAGCACCC
ACGCTCGCGTCGCCCGCCCATGGACGCGCCGTCTCGCTCCCGctccgccgccagcagcgccagcggcCGCAACCTCAGCGCCACGTTCCAGCACCAGGTT
CAAGTGCGTCCtggcagcgccgccaacTTGCGCGCGTCGTACCAGGACCCGCAGACGCACAAGAAGcgccacagcaacagcaagaagaacgcgcACATGC
GGCACTCGCTCACGCACGTGCAGACGGACGCGCCGGCGTCCGGTcgctccagcgcgtcgtccacgtcgggTTCGGCCTTGTCGCCGCCCGACCGAGCCTC
CAACTACCACAATATCCACACTACAAGCAGAGACTTGAGTCctcagcaccagctccatccagAGTATCCGGCCGCGCCCCCCGCGGGCGACGACATCCTC
AAGGTGGAGATCCCCAGATGGAAGTCCAAGCTCACGACGGACAGAGCAGACAGACTGCACATCCCTGCGGGCGCAGACAGTGCCGGCAACTCGCCTGTGG
GCAGTGGAGCTGCGAGATCGTCGACGTGGAACGGAAAAGATGGACGCGGAGGACATGGAGGCTCCATGGGGGCTTTGGTACTGGGACGAGACCGGGATAG
CGGCAGTAAGAAGCGGTATACGGTGTTCCAAGTCTACGTGCACTTCCAGTCGGGAGCGATGCGCGTGTCGGAGAAGAGATACAGCCACTTCCGGGAGCTA
CACAAGACGCTCAGGAGGAAATACGCCACGGTCGGGAAGCTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTATCATTGCGTGTGATTGAACAACGCC
GCGAAGCCATTGAGACGTACATGAATGCGGTGCTGACGTTGCGACCACGGCCGATTGAGGTCGTCCAGTTCCTTAGCAGTGGAAGCAGCTcggtggatga
cgaagaggaggatggCAACAGTACAGACGGACCGGCGCGCGGAGTAGACATGGTGACGGCGCCGAAGCACGTGCAATCGACGTCTACAGCTCTTGGAACG
TCGTCCCGGCACAGTGCGAGCAACAGTTTCGCCTCGGAGGACGCAGGAGGACACATGGTGACCATGCAAGACTTCGAGATCCTTAAAATGCTCGGGAAGG
GATCGTTTGGTAAAGTCTACATGGCTAGAGAGCGCGGAACGGATGGCAAGATCTACgcgatgaaggtgctgcgtAAATCGGAACTGGTTAAGCGTAATCA
GGTGGGGCACACCATGATGGAGCGTCGCATCATGAGCTCCATTGAGCACCCCTTCATTGTCGGACTCAAGTACTCGTTCCAGACGGCCAGCAAGCTTGTG
ATGGTCTCGGACTATTGCTGTGGTGGCGAGATCTTTTTCCATCTGAAGAAATTTCGCTCCTTCTCGGAGGCTATGGTCCGCTTTTACGCagcggagctgg
tggcggccATTGGCCACTTGCACGAGCGTGATATCATCTACCGGGACCTCAAGCCTGAGAACATTCTTCTAGACGAGACAGGCCACGTGCGACTGACCGA
CTTTGGTCTCTCTAAAACGGACTGCACTGATTTCACAGGAGCGAAGACCTTTTGCGGCACGCCCGAGTACTTGGCACCAGAAATGCTCATTAGCCGCAAA
AAGAAAACCGAGTACGGCAAGGCCATCGACTGGTGGAGTCTTGGCACGCTCATGTACGAAATGCTCACAGGCTGGCCGCCTTTCTTCGACCGCAACATCG
AGCAGATGTGCACCAAGATCATGAAGTCGCCGCTTAAGTTCCCTGCGCATTTCGGCCTGAGCTCAGAAGTCAAGAGCCTCATTTCAGCATTGTTGGAACG
CGACCCGACGTACCGAATCGGCTCGCGTCctggcgctggtgttgaGGATATCAAGAATCACGTGTTCTTTGCCAGCATCGACtggaagttgctggagaag
cgcgGCATCAAACCGCCTTTCAAGCCTCGTGTTCGCAGCCCGACGGACATTCAGAACTTCGACCGTGAGTTCACAAAGGAATTGCCTGACCATGGTTTCT
TGCAGCAGGACAAACGTCTCGCCGTGTCGCCCAAGAACGAGTTCCAGGGCTTCTCTTACACTCGGATGGAGGAACcggcgtcgtgttcgcgtGAGTCAAG
CAGTAAACGAGAGAAGCGCAGGTCAGGACGACGGTCGGAGCCACGAATCAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGTTGGACGTCGATCT
GGTGTACTGGGTCATCGTAGGGATGCCTGATTCTTGCTTCGTCTCTCTTGCATCTTGGGTTGGGCCTTAGAATCGAGCGCGAGTCCCAGTCAGCGGCAGA
TCAGCACTATTTTGAATTCGGCCTCGTCGCCCGCGACAGCACGGATTTCGACACTGGTTGTATCTAGAGTGCGTTGAAGTTCGGCCCAGCTGCCAGCCGG
ACGACGCGCTCATCATGTCCagtacaagaaggaggaggaagcaggTGGGCACCACCATCCATCAAGTACATGCGATGATATTTGTTTCTAATTTAGATTT
GATACAGGTATGGAGCCGATCCGAGTCGAGTTGTTCACTAGGAGACGCGAAATACGTTGTAAGAAAATGAATGAACCTAAAGATTACATGAGATTAGCAC
ACCAGCATCTGCTAGTTTCCGGAAGCAAAAGATCAGCTTCAGTGattgcagcaaaagctttcagttgcttgctgcctctgctgcttgcgatCGTATCCAT
AGAAAACCGGCATCATTTTGCGCATGGTGTGCATGGTTTTGTGGTCCTTGAAATTGTACACGCGCTGCCACTTACCATCGACGTTGGCATAGCGGTGCGA
GATCTCGCAAGATTGCGCTGCtttcaagaccaagaacaCAAAACAGTTAGTTCAAATAGTCGCATCCAGAATGACCATGGTTCGCGCAGAGCTGCCTACC
ATTGCACGCGGCACATAAGTCGTAATCGCTGCAGACACCGCAGTTAAATCGTGCTCCGGTGAATTCTGTTTCGCCACAGGAATCGCAGATGAAACCCAGG
TGACGACCCTCCATGATGTAGCGCAAGGTAGCAATCGCGTCCTCGTGACACTTGCGGAATGCACTACGAACGCGGAATTTCGGGATGTCCAACTTCTCGG
CCAAGTTTTCAACCTGTTCTAACGTGGGTGGTACCAATCCACTAGGCTTGAAGAGTTCGCGTGCTTCTCCATAacgctcaagcagaagctcgtACACCGG
ATCTAGAGAACTCGAACGTGAAAACCCGTTGAGACCTTGTGGCCGTACGCAAAATACTACTATATCCGCTGGCTGCAAACGTGCGCTTTGAGCTGATGCA
TCGTACGGAATCAAATCAGAGAGAACGGTGGGGGCGATCTCCTCTCGATACATTTCCAGTTGCGCACAGCTCCAACCTGTATGGCGTGCGACAGCCTCGT
ATAACACACTAGGTGCAAGATTTCCACTTTCATCGGACTTGCCCAGCAAATCGCGTCCGGGTGATGATGTCTCAAGAACACGAACTTTGCCGATGTACTC
TAGGCGACGGGCAGGGGCTGGTTGCAGTAGCTTTACAAACACGTATCCTTCCGGCGTCGCTAATAAATCACTTGCGGTCGTTATGTCACCAGAGGGTAGA
TCCAATGGTAGATCATTCGTCACCGAGTTGTTTTCGACGTAAATTTGGCAGAACGAGTAAGCGTCGATGTCTACTCCGTCACAGAGCAGGTGTCCAAAAA
GCGGTCGTTCTAGCTGAGACTTGTCACACGTGAGCAGTTTGCGTGGCCGAAGCGCCTGACCTGACACCACTGGCTGATTAAAGCACCACACCCGCGTCTG
GTTCATTGCTATATCTTCTTCCCTGTATTCCCCGAGCATTTCGAAAAACTGGTCATGCAGCGCAACCAGCAAGTTGCGAtgcgagcagcaaaatggcagc
tccagctccgccacgtTAGAAAAATCTACGAGTCCCAGTTGATGGTGTTCTCGAAGATCGTGCTCGAATACAACGCGAAACGTGATGGACATCAGTCGTA
CCTGAGCCGACACCGTGAGAGTATCGGGCTGTGCTTGGCCCTCAGTAGAGCTAGTAAGGAAGCCTTGCTGAGGGTCGCGCAGCATACTTAGCGACCCGAG
TGAGTGCACTCCCCAATTATTGAGGTGCTTGTGAAACTTGTTGTCCGTCAGACACGAATGCCACTCGAGTCGACGTGTCGGATCCAGTGTATTGTCCACC
TGCAGCGAGAACACGGCGCATGTGAGCCAGTCCGGAGGACGCCGCGACAAGTCAGTGAGTACGAGGTACACACTGAGCACGCGGCCTTTGTACTGAGCCT
CGTTCGGATTGCCGTTCGGAAAGACCCAAACGCAGAAGCGATGTGCGCCGATGGTGAACGTGTCCGACACGACTTTATCCACGTCTCTCATCGCTTCCAC
GTCGGAAAACTTGGGCACTTGCACCGATATCTCGGCCCGTTGTTCCTTGGCGTGTTTCTCCACGAAGCATCGTCTCCAACAGCCCCCATAGAGTCTCACC
AACTAGACAAAAATGATATAACAAAAAGTATCCATAACTCAGCTTCTAGACCTCTCCCACCCTAAAACTCTGAAGACATAGCTCTTCCGTACATCATAAT
CTGGAGCTCCCGGTAGTTGTGGCAGCACGTGTGTCCTCAGCGTCGGCCATTGTTTGACGCACAGACTCTTCCAAACCTTCCGATCGAACGTCAGCGTTCG
GAAGGTTCTGCACGTCGCGGCACATGCCAGCAGCGAGTGGCCATCCAGCTGTGCCAGTgcgagcgccagcagctcgtccggCAGCGTCCGAATGTCGCTC
GGAACCGTCTTGTCTTCAGTATGCTGCTCGTccatcatctccacgtcATCCAAGTCGAGACTCTCACAGTCCGTTTCGCCCGCTGAGCCCTCGCTGGCGC
GGCACTGGACGAGTCGCGGGTGCTGCTTGAcgtgtctgctgctcttgctgcgGGGCGGACTGAGGCCGCCGAGCCACTGGCGCTTCTTGGGGCTGCGTGG
GCGAGCCGACGCGACCATCGATCGGTCTAGAAATTGAGCAATGAATCcgattttgtttttttaCTGGTAGAGGAATCTGATGGATCttccgaagaagaaa
acatggaaagaagttgaagttggtgtttCGGAACACACTTTTATGTCATTCAGTTGCGGGAGTTTCGATACTTAAGCGGGAGTTGAGCTGGGTTTTGTTT
GAGCTTTTGGATTGCGTAAATGGCGTTGAACAGGAACTTCCGGACGACATATTACAAGACGCTGGGCGTGCCTGTGGTGCAGCATATTGTGGATGTGGAG
GCCTCCTTCGCAGCGCTGCTTAATGAGAGAGTAGTGAACgtgccgcagctgctgaagttgGCACTGGAATTGGGCATCGCGCCGCAGTATCGAGCAAGGA
gttggctgttgctggcggGGGTGCTGCCGCCCTATCCGGGGCTATGGAGTTTCGCGTTGAAGGAGCGATGCGCCATGTTTGAGGATGTTGTGGGGGCGGC
TCAAATACTTCAGGTTAAAGATGCGACGGAAAGCGACGAAGGAAGAGGAGTTTACTACGATTTCATGGAGCTtttggaggaggaagacgaaggacggaag
gaggagaagacgtCGTTGCAGGATCTGAAGAGGTTGGTGCACTTGCATCGCACATATTGGAGGGAAATTGCGGTGTGTGACGCGCCACTGTTGTGTGGGA
TGGATGACCCGAACTTCTTGTTGGGTGTGGCTCGAGTGGTGTGTGAAGTATTGACACACGAAGCGGAACGGTTCTGGGGCTTTACCAGGTTGTTGGAGTT
ATTCCATGATGGACTGGAGCTTGTGGATCCTGTGGTGACACTGGACACGCTGTATAATGCACAGCTTGCAGACTTTGAAGGAGTGTTTCTTCGTACGCTG
GACGTGAAGCAGAGGCGGTTGACTGCGGACGGATCGATGTCGAGTCTGCATATGGTCAAGAGTGGACACGATGAAGAGTATGGAAGACGACGGTGATAAG
TCAAATAACGCGCGCATGGCATTCAAAAATGGGCCTTCTCGTGACTGGCAGTTAAGCGAAACCTTCGATGTactcgtcctcatcgtcgctgtcgttctcg
GAACTCTTTTGCGTTTTACTAACGACGGATTTGCGGGAACGACGTCGTCGCTTTGGTGGGGCCTTGGGCTTTAATTGTTCTTCCAAATCGATATCCAGCT
GCTTTTGGTCTTTGCGAGCGGCGTGCCAGGCAACCATGAAAAGGTTCCAATTCAGCTCAATCGGATCGTCGGTTTGGCACAAGTCGTCGACAGAAGGTAG
CAAAAGTTTCTTGGGAGATCGTTCCTTCGCCTCCACTGGAATATCTGTGGCGGATGGTTTGTACGTCGCACATTTCTCGTTGTCCAGCTGGTAGTTGCGC
TGGAGCGCAAACTTCAAACGGAGCAACAGCGCAATCGCGAACGCAACACGACTGTTACTCTGTagcgtcgacaacttcgagcCCGCCAGCGGGCCCAACG
GGCGATACTCACCAATTGTTACCATTGAGAGATCCgattcttcgtcttccagtTGTTTAGGTGCCACACCCGCCTTTGCAAAGACTTCCTTGAGATCTTC
CAGCACAGGGCTAAACAAGAAAATAATTGTCAGCTCTCCAATACATAGGCGCTAGCATAGGAACGATGAGAACGTACCCGAGTCGAAGGCTCACGTAGCG
GTTGATCAAATAAATAATGTACAGCGGttcgtcctccacgtcgtACGGCAGCGTCGAAATGATCTGCGCTAAATAGCACAGATACTTTAAATCGCTCGTG
AAGgccttgctgttgttggcgGTGGTTGATTTGCTTCTCAATGGCTTAAGCACGCTCCCCTGGTCGGTGAACTGATTCACGAGAGCCTTAAGAAGAAGTG
ATTCACGTGATTTTGTCGGCTTGAGGCAATTCGTGTACAGTCGTCCAAAGAGGCAAAACTCCTTTTCGCTTTCGACGATTCCCAGCGCTGTGGCGTTGCC
GTACACATTGAGCTGGAACGAGTACGAATCCTGGATACCCTTAATAAGTGGTGTGTGGAATTGACTCCAGAATCTTTCATACAGCGCCATCAGCTGAGAG
AATGCTGCATCCCGAACTTCCGGCACGCGATCGGTCTCAAGTGCCACCAAGTTTGGAATGCATTGCAACGGGTTCACCAAACCTTGTGTAAGTAACGCGC
CGATGCATGCGATAGCCTGCTTTCGAATTTGCGGCACCTTCTGTATTGATAACAGCAATACGTTTTCCAGCTCCGCTTGCATAACGTTGCCGATCAACGA
GGTGTCGGCTTCCTGGTCGCCTTGAACTTGCTGCTCCTTACTCTTCGATTGATTCATTGTTCGTGTCGCCAGCCCGTTTTCCAAACGCTGTTCTTCGAAA
AGCAATAGCTCCTTCATGCTTACAAGGCACTGTAACTTCGCCTTCAGAGTATTTGATGTCAAAAGAAAGTTTAATAACCCATCTTGTTGAGCCCGGAGAA
ACAGACGCGGCCGAATTGGAAATAAAAAGCCCATGCCTTGCACAGCTTTAGCGGCGCATGAATCGTTGCCTGGCATGCGAACGAATTGACCGTACAACTC
ATAAAGCGATTCTGTAATCGTTCCAATCGTCAGCACTTTCGCCTCCTTTGCTAGTTCCTGACACTTATCAATGTCCGTTGCACCAACAATTTTTCCCGCT
GCGAACAACGCACGCTGAAGCACATTATCTTTCTCCGACAAATTCGCGAGAGAAGTCCTCTGTTTGTACTCCCGTATGCTGAGAAAAAAACGTTCCAGCA
ACCGAAGCAAAAGTACTCGTGCCTTGTTTCGAGTTCTCGAGAGAGTTGCCAGACACTGGACACTTGGACCAACAACACTCGGGGGAGAGCGTAGCACTAA
AACTTTCAAATCATCTTCCAGTCTTTCAGCAATAGTCTGTGGGACTCGCTTTACGCTCAAGATATTGTTAATCATGGAGACAGATAAACCTTGgatcttg
gcgtcctccTCTTTCAGGTATACTCGAATCGTCTCGAGGTGGCGAGCCAGGAGCTGAGGTTTTGCTTCACAAAAGGCAGACAGAGCAGTCATGCACGACA
CGAACTGTTGATGTCCGTCTTTTATGGAAACAGCTTTGAGAAGTGTGCCTTCCTGCAGGTCCATTAGGCAGTCCACAAGGCGGGTAATTATCTTTTCCGA
GCGGTCCTCAGCGATTGCAACTTCAGCCGACCGATTTTTAGTGGATCGTGATGCCGTTTTCCTTGTGCTGCTATTGCGGCCCACCAACAGTCTTTTTAGC
AGCTCAGCAAACCAAGCAAGGTTTGGCATACCGTGAATGACTTCAATGATAGTCGTGACAACTTCAGAACTGTTGTCCAGCTTTGAGTCGTTGCTCTTTA
CTACGCTGGCTGGTGTCACCATAGGAGTTCGATACGAAGACCACGCTTCTTCGACCGAGGTGGCGACGATCCCATCGTCGGAAATAAACTTTGTACTTCC
ACTTGAAAGCAAAGTGCCATCACTTTTTTCATCGACCTTCGTAGCAACAGAAGTCCAGCCAGGTGGTAGAGTATTTCCATCACTAAAATCACTTAACGGA
TTGGAGAGTCTCGACGATGATAGCTCAGCACCAAACCATACTTCTTGGAAAGTATCGATGATAAAGTTCTTAACGCCTTGATCTTCAGCCGCGTCTCCGA
TCCGTTCAACCAGGCACCGCATGCACGCACTTTTGCGGCGAAGCTCTTGTTCTGTGGTTACGTCGCGGGCCAAAGCTATCTTAAAGATTTTGCATACACT
TTTCCGAACTTTGATGCCCTTGTCACGCACCCTCGCAGCCAGTACGTCGAAATATTTGTCAAACTGTCAACACACGCAAGTCAACATCATTAGCATATAA
CCACTTTAACCTAACAGGGATTTTCGTACCAGAAGGGGCTGCAACAGGACGTAAGTCCCGATCAATTCCACGGCTGCTTCACGAACTGAGGGCTTTTCAT
CCGAGCAACACCTCTGAACAGCTGACTGCACTTCACCTTCAGCCATCAACATGGGATCGACATCGACAATAACTCGCAGGCATTTCATAACTCGCGCTCT
CAGACTTGGCATTCCTTTAGAAAGCAGAGCCATAATATGCGCGAGCAAACTGTCGAACAGGCCACAAAACTCACGTTTCACAGCAAGGTGCAAACTCGAC
TTTAGCGCCAATTCACTTGTAGGGACGGCCCCTTTAAACTTCAAGTCAATACCCCCCTTTGACTGCTCCCACGATGACACCCACAGATTATTTTCTCGTT
CCACACAAGTCGACTCAGTTTTACTCCAATGAGCTCCCGATTCCGAGATGAATTTTAAGatgaacagcttcttcgaaTCGTCTTGATTAAGGCTATTCCG
TTGAAGGTGCATCAGAACGATATGCTTCAGTGCCATTTGATGAAACAAAGCCAAGCTAGCGCTTGGTGGTGCGCCTTTGGACCGCGTTTTCATACCAGCA
ACGGCTGCACGCAGATTGTTTGTATGCTCTTCAATGACTGTAATTGAGTCACTATCCTCCTCCATGGGGTTCTGACTAACCTCCTTCTGATATCGCTTGA
TTGATGCGCATATTTTTCCGACCATATTGAGCGCAGCAAGACTTTGATGTGAATCTGGGTTCTTCACACTCTCGGAGATATTTGCATGTAGGATACTCGC
CAACGACGAACTCAATGCCTCGAGAAGATCTTCCGCTCCTATCCATTCCGGGCGTACAAACATCACGAGGAGGTCTTCAACAAAGTTTTCCAAGACCACG
CGATTATCACGCTCTTCGGTTTTCTTCCAGCATGTTTTAAGAAGCTTCCGAACAAATGACCGCGCACTGTTCCGTGTATCCGCCAGTGTACTCTCTACCA
CATCATTTTTCTGCGGAGACTTTTCTTCAGTGGCAGTATCCGGTGTTGACGAAGGTTCAATTGAGTCTAGTAGCAGGCCAGTATCAGCATCGTGCAATCT
AAGTGTGCGTGCTGGAGCGCAGGCCTGTATCATTGACACCACTAACGTTGAGACTCGCTGGATTGTGTCGGTCGAattcagcaacttcaccgTTCGCAGT
GTACGTTTGGCCGTAGGGAGCTTAAGCATGACCTCCACAATATCTCTGAGCAACGACTCTCGGTGGTGTTTATACCGCAGAAAAATGCCTCGCAAAATAG
TGAGAGCACTCAGCTGCAACGACGTCGCATATGAACTATGCTCTAAAGCAAACAACTCCACCATCGAAGAAGATAGTGGGAGTACCCACTGATCTGAGAG
TTTTACACTCAAGACAAGTGTGGCCAGTTGATCCATAAACTCACAGACGACATGGGAAGCTCGGTCAACGGCCTTGCGAATGTCTTTGTGCGCACGTAGA
TTTACTCGAGAAAAGCTGGATGTTTTGCGCCCAGTTGACTGTCGTCGATTATTTTCTTTTACCACTGATGTGGACGCAGTCGTGACGTAAGTGGTGTCGA
TAcacggaagcagcagccggcGAATGATGTGATGAAGTAGTTGGAAGCAGTTGTCAATAATCTCCTCCGAGAGAATCCGTCGATCGATTTGGGGCGTTGT
CATCACAATAAGCTCACAAATCGCGACATCAAGGGACGCTAAAAGGCGCACAACCAGTCGATCATCCATCTTTTTAGACTGAGATTTCCCGTCCTCTTTG
TTTGGCAAGACAGCTCCCAGCACATCCACTGCTAAACCCAACCTGACCTGGGTATCGAACGCGGTCATCAATGAAATCAGCAATTCTGGCTCCAGCTTGT
TAATCCACTCATTCTTTTCCATTGCTttcagcgactgcagcagcatcttcacttCTTCGGACTCAAACACATCCATGTTATCCTGATCAAAattttcctg
ctgctgccgataTGTCGCCATGTCAACCAATCTTTCCAACAATTCCGCATACTTCTCAACGCTGTCTGCAGTGATCTCCGCCTGGGTAGAAAGCGTCgca
agctcttcttcgtcttgcatctcctcgtccacttcTAGCCCGGCATTCAACTCATCCAAAAATTTCTGCAGCTCGCCACCTTCATCTTTTATCGAGCTCT
CATCTTCTCCATTATTACCTACCGATCGCCTCTTCCGTGGTCGTCCGTACTCTggttcctgctgcagttccaAACTTCTCTTCGTAGGTGATGGCTTCAC
TCCATGAGTAGCCCCACCTAATAACATACACAATGAGTTAAAGCAACCGTTAGTTTCCCATACAGCATTGCAGTTGCAACACTGATAACAAACAGCACAA
AATTCCTCTATTGACCGTTGAAGCATCCAGTCTGCACCACCGCCTGCGCCCACTTGGGCAATGAGTTCAACACGTCCGCGTCGATCTCTGTCGTTTCGCT
TGCTGAGCTACCGAGTCCATTTTCAATGCACAATATAATAGTTTCTATTAGTATATAATATAGTAAAATAAAAATGAAAGAGTTACTTGTCGCACCCGAG
TCTGCCGGTGGTTGAGGAGCGAATGAGCGTCGCCAACCGCTGCGGATTGAAGGACTCGACTCCTGACGTTGGTTTTGAGGTCACCGGATGCAGTGTCTCG
CGTGCAtccgctgccgctgcgtcCTGCGGATCCATGTACAACGGGAAGAGGAAGAGCCCGCCCCGCATCGTCCTCGGCCAAGTGCGCACTCGTGTGCTTG
CTTGGTTGCGAATGCGGAATGAGAGTGATTGTTTCCTTTGTGCCAATTGCTTGGATGTTGCTTGAATGTTGCATCAATAGGTGATACTGATGGGActcga
ccacttcaaccgTTGCCTTTGTCAGCATCAATCATGTTGGGCAAGTGTGCAGAAGGGAATGCATTGAATGTCAGTCTACCGGTAGTTGCCTAGTGTTTGA
TGCCACCATTATGCATCGATCGTCTTACGCAACTTTCGGGCGCATTTTGTACGCGCCGGGCATCGGACGCTTCTTCCGCCCTCCAGACGTGAGCGCTCCC
GACCGGAAGATTGCATACAAGATGCGTAGCTGGTGCATCGACGACAGCACAAACAACAATTGAAGTTAGCGACAACTTGCAGGCATTGACATTAGATCCA
CGTGACGGAGTACTTACCGTGTTCCACATCCAGATGcagtgcagcaccagcttggcAGTGGGCAGTGgcagcacttctccagctctaGTCAGGCGGTTGA
TCGGGGCGATAATGTCGCCGTAGAGCACTATGGCACACAcaaacagcaccaagcgGACGAACTGCGCTATGTCAGCTTCGGGTTAAAACACTCGGATAGT
TGGCTTCCATACACGTTATCTTACCAGCGCAGAGCTGCGAAAATACATTAACAGCGTTGCCCCCGCTGCCGCCAATCGCACTGCTTCTGGCTTTTTGTAG
TCCAGAGCACACGTCACACTGAGCAACCCCACCACAGCCTGCAGACAATTTTGCATCAACGGAGTTAGGATCACTAACCACTAGTAATTACCCTACCAAC
TACGTAGAGTATTACAAGTTGGGTGTAGATAGTGATGTCGGTGGCTTGCGAGCGACCGGCAGTCGACGCCGGTCCCCACAGGGTCCGATCCAGCTCGTTA
TGATGCAGCACTACCATCGATCGATCCGATGATTTGTACACAATGCGTTTTCCTCTCTTTATGGAATACCACTCCCCTTTACAAGAGACTTTAAAAAGGT
TTGCTTGCGTTCACTAATAATGCATCCTCACTGCGTTTGAGTTAACATGTAATCATGCCGCTGTGCTTCATTAAACTAGGTATTGGTGTATTGGTGATTC
GCGTCGTTTTTCAACCACGCAAATTGAAAAGTGTAGTCGGCGCCTG