Description :
From Genome Similarity Track
Location :
Scaffold_399:11761- 13337
Transcript NameFunction/comments
Hyaar_Emoy2814027membrane protein

Sequence
1576 bases(100 bases per row)
AGGCGGCTGGCCAATTGGCGTGCCTGCCCATCTTTCTTGTTGTGATATTCGGGGCCCACTCGATGATAATGAGCGCCGCGTTTGCTCCTCCCATCCAAAA
GTGGAAGGGAACTGCGTGGAGTTAATTGGTGTGGGCCACGCCACAAACACACACTCATCCCCGAGCAGCCGGGCCGGCCGCCCGGACGTACCATTTGCCA
TCTTGCTGGCCACGACACACGCCAACAGAGTCCTTTGGTTGCCAGGCCCTCCCTCGCGCAGGGCGTCAGTCGGACCCGTTGCTCTCCGCTCCCCCGAAAG
CCGCCAAATCATTGACCACCACCAGCAGCAGCAGCTATTGATCCCTCGATCTCTACTTTGCAACGCACTCAAGACGTCGCCGCCGCCGCCAAAGGGACTG
GAGCGAACCACCTCGTGCACGTCAACAACCCAAGGAACCAAGGAACTGACCAACCAACCAATTAAAAGCGAGATGGAAATTGCCAAGAACGTTCGGGATT
TCCTCGTGGGCATGAAAGAGACGCTGTCGCCCGAGGAAGACCAGCTGTTGTCGAGTCTCCAGACGCTCCACGAGCAGTACTTGAACATCATGGACGACTT
CTCGGTGCAAGTGAACGAGAAGGCGTTAAGTATGAGCCCCGAGTCGCGCGTTGAAGCGCATCAATTGCGGCTCAAGATTTACCAGGACTGGCGCGCGCGA
CTCATGGAGTGCGTGTTTGACAACTCGAAAGAGATTGCGTCGGTTGAAGACGCCGAGACGCATGGACCGGACTGCGACTGCTGTTTCTGTGAGCTCACGC
GGCGACTTGACAGCTACGAGGCCGTGATGGCCGACTATATTCAAGTGAAAACACGGAGCAAGGACCCGGAGAACGACTGCGCCGAGTCCTTTCAACTGCC
AGAGTTTCTGACCACCTAAAGTCAGTGCTCGGTGGTGGCACGCCTAGCTAGTTAGGGAGGTCTCAGCAGCGACGGATTGTCCCGGGACGACGACCCCGAT
CAAGGATCTTGTGCAGAACGAAGAGAAGGACTGCAAATTGCAAGAGGGAACCCGTCAGTCAGTCAGTCGGTCGATCATTGGGGCAGTGACGAGAGCCTGC
TGAGCAGTACAATACGTGGAACTACTATAAGAAGAGTCACCTGCGTCGTGTCGCGAGCGTGGTAAGTCTGCACTCGCTGGGACGCGAGCGAGCGGGTGGG
TGGGTGTTAAACAATAGAGTGCGCCGATTGCGTCTTTGCCGTCACTGGAAGCAAGCAAGCGCGTGTAGTAGTCGGTCGGTAGTGGGATTACAACCTCCTG
CCTCAATAATGCGCAGGGGTTGAGTGATTGATTGATTGATAAGCAAGTTTATAAGTACAAAGAGCTCGTCCTACTCATCGTTCTGGCTGCTCGCGAGCGC
TCATGGCAGGAAGGAGAGAGGCATCGACGACGGGGCTCTGCACCACACAACCCGCTTACTGCAGCAGGGAGAAACAAGGCGAAGAAAGCGGAAGAGTACG
CGCGCGTGCGAATATCTGCCGAGAAGCAGTACAGATAGATAGGATAGATAGAGAGAGCTTCAGAAAACCAGTTTGT