Description :
From Genome Similarity Track
Location :
contig_59:117589- 120607
Sequence
3018 bases(100 bases per row)
AAACTGCCGGAGCGATACTAGGACGATACAGCAAAATATGCCTCCATATCTGGAACCACATTCCAGCGAGAGGGAATGTCGATTACAAGGCGCCACTGCA
TGCCCTCACGGGTAAGCCGCCGCGGGTGGGGTGCATTCTGAAATTCGGTTTGCGATGCACGATGCATGTAGCTCAGAAGACTGGAGTCTCAGTGAAGAAA
CGAGCGGAGAAAGGAGCCATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCACGTTTTTCGATGATCTCGGCGA
ATATCTCTCGCAATAAATTAAGCTCCCCTTGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAAAGCACAGTTAGCTAGCATATA
GCAGTGAACACACAATTCGATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAGTAGAGCACAGATGCGTGTGGG
AAGCCGACAGTGGCTCCTGCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGAGGGCTCGTACCACTGGTATAG
CGACCGCTTCGTTAAACACCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGGTAGCAGGGTTAGAGTTTCTCC
ATATGCACAGCTTCCCGCTGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTCTCAGTTTGGACTGCAACGTAT
TCTTCATTGCGCTCTCAAAGGGCTTGAAGACGGCAACATCAAGTGGTTGATACACGTGCGTCGCATTATCGGCAGTATTACCTCTAGTATCTTCATGTTG
AGTGCTGCTCCATCAGATTTTACCCAGCACTAAGGGATCGATTTTGGTGAAACTTATTCTCCAGTACTCAAGATCACCAACTTGCGTCTGCTAGTTGCGC
TGGCAGCAGCTTGGAGACATCGTTTGCGACAAGGCCACGTGCCAAACATATATGTCAAGGCCACATTGTATTGTCCGACGTTGATGAAGGCCCCTGCGGT
ACGTCGGAGGGCAATCACACTGCATGACTGCTGCGGAAGTCACTTTATGGTTGAAATAGAGTCATCTTCGATGAAACAAAACGGTCAACGCGTTTTTGCT
GCCTTTGGGAACTGTAAGAATCCGCTCCCTCCTGGATTCTTTGCGCATCCCTAAAGTACCTCGCACTGGCCCTTAATCCTGAATGATTGTGGTTGTACCG
CCAAAGTGGTACATCACGATCGTAATTGTGATCGTGGTGGCGATTGGGATCCGGCGTATCGAAATCATTGTACCGTATATCGATCTGATCGTGGTCGTTT
GGATCGACTCATCAGAATGATTGCGTATATCATAATGATTACGCTTGCGACACGACTTGAGACGTGACTTGGGACACCACGTGTCTCTCATAAATCCTTC
TACGCACTTGCCACACAAGTGGCGTGATATTCTCCTATTTGTGGATCGTTTAGCAGATTTAAGGGTTTCTCGATGGCACGTGTTTTTTTTAACATTGTGG
TTAGATGGTCGATAGACACTTTGACCCTACTCGTCCAATATCAATGGAAAGGAGGCAAATGCCAGACATTTTTGAGCACATGCATCGAAAAGAAAGACTT
GAAGAGAAGCTCGGCTTTTCGGGGCGACGCACTTCATCAGCAGGCTTCCATCAATTTACAGAGCAACGAAAGCAACAGACGCTGACGAGTTGCGATTTTC
TGGATCGACGAGATCGTGGCTTCACCAGTTGTTGCTCTTCATGACGGTGATAATAAAAAGATAATAGTTTGGTAAATACGGCGTGCGGTCGAAAGGTGCA
TGTCATCAAATGCATCGTCCATTAACTAAATACCCCTGTGACAGGGCTTCAATCTAGACGCTACTGTTGATGTTCAATATCATCAAGGTGAGCCATGCCT
GGAAACGGGTCATATCGCTTAACGGAGGCGGACGGGTGTCTGCCAAGATTGTTTCAATGGTACGCTTACGTGACTCTAGATGGAGGCGTTGGCCGTTCAA
TCGCCCCCGAGCGCCTTCCAGGTTTCACCTAGCTCCCTGTTGTCTTATGTGGACGCATCAACGGCTTCACGAGCCACGGATGTCGAGCGTGACGTGAATG
ACTTGACAGCTGCCGCTCAGCTGGCAAATCAGCAGACTGGAGAGTTATCTTATATCGCATGATTCCAAGTAGAATGGTTTAAGCCACGCATTTTGTGGTT
TGCCCACATTCGTCACACGACAGGGCCAGTCTGAAACGTTGCTGCCCATATATCTTGCAGCTGAGCTACGACGCCTCGAAGCGAGCTCTCAGCTGCTGCA
CCTGAGCGATCAGTGAAAGCCGGGCGAATGCACGCATCAAGAAATTCTTCCAAATCTTGTGCCTTACTAATGACCATTTCATATTCGTATATCATGAGAC
AAATAGCTTCTCCGCGAGTTGAAATAACTCACCGCCCCAAGCTTGCTCAGTCTTAGCGCTGTCGACCAAGTGCTGGTTCCCTTTAAACTGCACCTCGCGG
TCTCTGCAACAATCCAGGCTCCTTCCTGCCTCACAAATTGACTTTTAACGCGGGAGCTGAATTTGATCCATAGCTTGTGCATAACGTTTTGCAATCTCGC
GCAATTTACAACGAAGTCATCTAACGTCTTGCCTAACGTCTCGCGCTGCCCGACCGTGCTGTTCACAGTCGATCGAACTGCCAGCTGTAGCCGATGTTGC
TCCCCAGTTGATGGTGCAACTGGCGATGCGGGAGATACAGGTCGGCCAGCGTTCGTTGGGGCCGCTGGTGGTGCATCTGGAGATGCGAGAGATACACGTG
TAGGTCGTCCAGAGCACGTTGGGAGAGTGGTGCCACCATATCCGCAACCAGTGCACCGGATGTACGGTTGCACGTGATCATCACCAACAGACGACGCTAG
AGGAGGTGCTCTCTGGTG