Description :
From Genome Similarity Track
Location :
Scaffold_25:117562- 119217
Transcript NameFunction/comments
Albla_Nc14029090

Sequence
1655 bases(100 bases per row)
GCCCGACATCATGTGCGATTACGAATCAGGCCGCTTGGAGAACAATCTTGATTTGAATTTGTTACAAGATGGAAATGAACTAAGCGCACTAGCCAGCGAT
GTGAAGGACTCCAGACCATTCAAAGTTGCAAATGTGATGGTAGTCAAGTGGGGTACCAAAGGCTCGAAAAATTTGCAAGAAGTAGCAGCGTTTGAGGATT
GCTTCATCTGTCTCACACGCAAGCGCAAAGTAGTGCTCATATCGTCTAATAAGCGATATGTATGGATGGTGGATTCCGGGTCATTTCCAAATTGCGAGAC
ATGCACTGATAAGGTTACATTTGGCCCACAATTTCCATATAGTCAATATATTGGGCAGAGATCAGTTGAAGATGCAAAGAAATGGATTGGCGGTTTTAAG
CAACGGAAGCGATCTAGAACTGACGAATAGTAATTCGACAAGACATTTGATGGAGATCAAACTCGATCGAATGAAGGATCCGCTGGATGCAAAGAAGATT
CAAATCAGACCAACGCCCTTCTTTACTGATTTTTACTGATGCCAGTCCGTAGATCGGATAATATAAAGAGATGTGAAAACGAACATGACCTATTGCCTGA
TAAGTGACTATTTCTTATGCTCTGCTACAGGTTTCGCTTTATTGCAGAAGAGCACGTGTAAATCTGTAATCAATTACGACTGACGGTGCAGTTGAGGTTT
GCGCGATTTAGCTCGTGTCAATCAAATGCGAATCGTTGTGAATAGATGTAGAATAATATTCACGTCTTGGAAAGCCCAAACGCCGGGGGTGCTACTTGTG
ATCTACGCTACACATCAATTGATGTGATTCAAACAGAAGGTTATCCAGACGAAAGATTCTCTTCGCGAGAATCTATCGGTTCCCGCGAATTACATTGACT
ACGGGAGTCGCTACAAAAATAAATGCTTTGTCCTACCAAGACCAGCCAGCGATAATTCTTCAGGTTATAGACGAACATTTATGAGTCTCAAACCGAGCCA
AACTCCCGTATCGCCAGATCGACAGCGACCATTGGGCCCATAGGCATGTGTCACTCTTCTTCAGAAAAAATCCAAACAAGACCCTTAGAATGGCTCAGGC
TTACACCAAACGAAAGAAGCTGCATCGCACATCTGCAACAACTTATGCATGTGCAAGCAGATTTAAAAAAGACAGTGTAGTCACTGAATGAGTGATGGGT
TTGGTATCAGGTAGGATCGGACAATAAGTACCTTGAGTATCTTTCGAGATTTGGCGTATCTTTCTAGATATCACAGGAGCATCTTGTTATTTGTCCTAAA
AGATGAGTACAACTCACTCGACGTTTTGCAGTCGGAAAAACAGATCACTGAGCAATATTATCACCGGACCACTCTAAACGAAAAAATCACGGGGCAATGG
CTTATAGAAGCTCTTCAAAATTTCTTGATAAAAAAATGAGAATTCAATCATCTGGAAAGAGTGCGGAAAAGTATTCTAAACAGATGGGGGCTGTTTGTAG
GAAAACCGCGGGACGACATGACCAGTTGAAATCAAAGAAACGTTATGCTGAATAGCCGTGTATGAAGGACTACTGGAGGAGGTATACCCTTGTCATCATT
GGACACAGTAACACTGAAAAGATAAAGCGAGTCTTCACAGGTGCAAGCTTCAGAT