Description :
From Genome Similarity Track
Location :
Scaffold_137:11755- 17022
Transcript NameFunction/comments
Hyaar_Emoy2810778ATPase family AAA domain-containing protein 2
Hyaar_Emoy2810779vesicleassociated membrane protein putative
Hyaar_Emoy2810780hypothetical protein
Hyaar_Emoy2810781hypothetical protein

Sequence
5267 bases(100 bases per row)
AGGGCTTCTGGCTTTGCCCTGACTGCTTGGGCTCTGATTGCACTGTGCAACAAAGAGCACATCACGTGCAAAAGAAGCGTGTTCACTCTATAGCGAATCT
TATGTTGCCCCGCCACTCGGGCTTTCCTCGTGTCTTAATTGCGGGCAAGGCTGGCATGGGACAGCAGTACATCGGTCCGGCGCTACTACATTTATTAGAA
GGATTAACGCACTTCTCGCTGGATCACCCTTCGCTTGTGGCCGACTCCAACTCGCACTGCCCGGAAGAAGCACTCATTCGTAGACTCACCGAGGCCCAAA
AGTGCTTGCCATGTGTACTCTATCTTCCGCAGATTGAGTTGTGGTGGAAGAATACGAGCGAATCGATGCACCTGACTCTGAAGATGATGTTGACGAATCT
TCAAGCTCAAGCGAGTCTGCCAATCATGTTTCTAGCCTGCACAGCGTCGACCTCGTGTGAAGGGCAAAGTTTACCGGAGGAGTTGCTGGCGCTGTTTCAG
GAAGATCCGAGCGTATCCGCGACATCTGTGGTCATGGAGCTGTGCACACCAAGCAAGTCTGAACGTTATGCCCACTTTGAACAAATATTTACCTCGCTTG
CTACACCCCCATGTCTTCAGAAAAGCGAACGAGCCAGCCATCTCGAGGTGCTCCCGCTGGCGCCACTTCCACCTGCAAGACCCGAGATGAAGATGACGTT
GGAAGAGCAGCAAAGAAGAAAAGAGCGAGACCTTCACTTTTTGCGTGAGCTGCGCATCTTCTTGAGTCAGGTGCTGGTGTACTGCTATTCGCAGAAAGCA
TACACACCTTTTTTTGTGCCGGTGGATCCCGTTGCAGTGCCGAATTACTACCTGATCGTGAAGCGCCCCATGGACTTGAGCACAATACGTGACAAACTGA
ACGATGAGGAGTATACATGCTTCGAGCAGTTCATGGATGATATCCAGCTTATCGTACGGAACGCCAATGTGTTCAATCCCAAGCGCAGTACCACGCGGCA
CATCGCGCATGCGGCTGGTACGATGAAGGATAATATCTTGTCGTATGCCCACCGCTTCCGCATACGCCAAGGTTACGACCTTTTTGCCAAGTGTCGCGAG
GTGACGAAGCGGCTCCGAGCGCATCCAACGATGTACGGGGAGTATGGTCAACGATTTTTGGATTCTACTGGAAAGAGCAGTCGCACGAATCACGCCTGCG
CATCCGAAAAGCCTGGCGTGCGTGCCAGTGCGCGGCTCCGTGGTGTGAAAGCTCCTGATCTTGGGTCGAACGAAGTGACATCTCGCGCGACGGTAAGCAC
AGACAGGCCTGCCATCTACGAAGTTGCTGCAAAGCAGGAGCCTTCGGCTGATGTTCAGGGCGACACAAAAATCATCACGCGGGTGGCTCAGTGGTTCAAC
GATGAAGAGGAGGAGCGGAAAAAGAAAAGTGGGGCAGGCGATTGCATTAAAACAGGAAGCGGCAACAAGGCAGCTGCAGAGGTGGAAGAAGATCGAGAAG
AAGAGGTGTTTGAAGAGGGCGATCGCATTTTCGTGAGCAGTCGAACGTACCCTGGTGTCAACCGTGAGGGTGGTGCCGGTGTCGTGGTGAGCTGCAATAA
AGACGGCACGTACAATGTCAAGTACATTCTCGGTAGACGCGAGAAGTCCGTCAGTGTCAAGTACATAAAAAGGTTGACAGACACTGCTGTGATGGAGTCC
GTGAAGACACAACGGTACGTGGCCAGCAAGACGACGGACGCAGCTGGATCCGTGCGCCTCATCCAGGACGAAGAAAAGATGGATGAAACGGACTACTTTG
ATGAATTATTGTGGCCCATTTTGAGAGAGGAAGGGTGGAAACGTGTCGACAACTTTGATATCATTGAAGCGTCGGGTGAGGAGTCCGGTCTGGCCGTGCA
ACGCGTCGTCTTTACCCCAGGCACGAAGCAAAACGGTGAGTCCGTGGCTCTGAATGGTGTACTGGAGGCCTTGGAGTACGTATCGGCAGACGTTGATTTA
TCGCATAAATGCTTTGGCTATCGGTATGCGGAAGGCCTGACAGCTGCTGAAGCTCCTGGCGAGAGCAGCAGTGACGAAGGCATCGCTGAGATCGATAAAG
CACCTGTAATGGAGACGAAGGCTGCAGCTGTTGAATCGAAGGTTGATGAGCCTGTGTACGAGGCGCAGGACGATGAGCAGGTGAAGGACGAGCAGAAGAT
ACCAGACTTTATTTATGACGAGGTACAGTGGCGCAGTTTTGTTTGTGTACGTGAAGGTCCGTTGACGGTATACCCTGCTTGTCAATGTTTGCTGTAGGCT
CGAATGGCTGCAGTCCTGACGAAGCTCGTGAAAAAAACAGCCAACTGGACTGTCGACAAGCTGCGCGACGAGCTGCTAGTGCTCAACAAGTTGGTGTACC
CATTTCGCACTCGCTTTGACCGTACGAAGCTGATGATGGTGAGAAAACGCGAGTCTTTCAACTGTTTTGATGATGATGGCATGTCCAAAAAGTTGCCTGC
AAGCGCTTGCTAACGTTTGGTCGTCTTTTTTGGTCTTTTTTCTACCTCTAGCTCCTTGAGGCCCACGAAGTGGCGATGCAGTCGTAACAAGAATAAGACA
GCGATTACACAGTCTATATATGTCGGAATTAACGTACTAAAATACGTGATTACTCTCCCATTAATAATATCGACTCGCCAGTCCCTCCGTATACAAATAC
CTCTCTCACTATCGAAGATACCGCTCCGTCGCTTCCTCGTTCTGAGAAATTGCAACCGACTCACAAACCACCACTCGGTTCTTCCTTCCTTCCTTCCTTC
AAGGTCTCCTCCGCCACCACCACCACTACCTCCTATGCCGATTGTATACGCCCTCGTGTCGCGTGAAAAGACCGTGCTGGCCGAGTATACCGCCACGTCG
GGCAACTTCCCCACAGTCACGCGCGTCCTATTAGCCAAGATCCCCCCAAGTGACGGCCGCATGTCGTACGTATACGACCGCCACCTGTTCCACTACATTG
TCGAGGCTGGCGTCACGTACTTGTGCATGGCAGACGACGATCTCAAGCGCCGCGTGCCATTCCTCTTCCTGGACGACCTCAAGAAGCGGTTCCAAGAAGC
GTACGGCGACCGCGCCCGCACAGCCATCGCCTTTGCCATGAACAGTCAGTTCCAGCACGAGATCCGGCGTCTGCTCGAGTATTACAACGCGCACCCGGAC
GCGGACTCGCTCTCGAGGGTCCGGCAGCAGATTGACGATGTCAAGGACATTATGGTCGAGAACATCGACAAAGTGCTGGACCGCGGCGAGAAGTTTGAGC
TGCTCGTGGACCGCACGGACAAACTCAACCGCCAGTCGGTCAAGTTTGAGCGCTCGTCGACGCTCCTGCGCAAGTCGATGTGGCGACGGAATTTCAAGCT
CTGGCTGCTGCTTGTAGCGGTTGCACTGTTTGTCGTTTACCTCGTCGTCTCGATGGCCTGTGGCTTTGACTTTAGCGGCTGCTCGGGCAAGCGGGACGAC
GTCTGACGGGCACGTGAGGAACTGATTGATCGATTCATTGATTCAGTGAGTGAGTGAGTACGTCCTGCTGCAACAAAACGACACGAGACTCGAGAGTAAC
AACAAGAACGTGCCATCGTGACGGAAGTCACGGAGTTCTTCGTGTGCTACTTAGTCCGTGCTTCTCTTGTACGTGTGTGTTTGTCGTCTATTGATTCCTC
GTCATCTATTGATTTCCTAGCTACCTACTCATCGATTCACGGCTTCATCATTGGCATATACTATGTGCTGGCAGACGATGACGAGGTGCAGGTTTCTACG
GGGCAAAGTCGAGGGCGCGGTCGAAATGCGTCTCGGACGTCTTCCGCACGCCGTCGTGCCAATGGCTCTCGATGTTGGCATGCAGTGCTTGGGTGATTGT
CTTGTAAAGAGCTTCGTCTCGGCGCAAGAAGTGCACGAGCACGAAGTTGCAGCTGACAAAGGCCAGCACCTCCATGGCCACATCGACCTTTGGGCTCTGC
AAAGCGCGCGCGAGTCGCGTGAACACACGGCGTTGCAGCGAGTGCGTGGGGTCCACTTGTTCAAGTGGCGGCCCAGACATAATGACTCGAGCGACCATGC
GCGTGGCCCCCACCTCTTCTTTCGGGTAGCGAGTCGGCCACCCACTGAGCAACCGCTTGAGCAGTGGACCCGTGACGGACGGCATGTACGCGACGAATTG
ACCGGCGCAGCTAACGAGCTCTTCGTCGTCGGATCCAGCGGGATCGACCCAGTGGGCGCGCCAGAGCGAAACGAGACTGACCATGCAGTTGCGCACGAGT
TCCGTCCGCTCCTCCTCCTGCTTTCGAGCCGCATCGGACTCGTCCAACAACAACGACGGTGGCTCTGGCTCTTGCAAACTCTCCTCGACATGTTCGATCG
AGTACCGCAGCAGTTCCGTGAACCCGTGGCCGTGATCGTGCTTGTCTGCAGTAACTTGCCTCGACGTTTTCTCGACGCCTAGTGCCTCGGCACGTGCTGC
GACCGCAGTCACGTACTCGATACGCAGCGCTGTGGCATCCGCTAGTGCCCGCACGAGGTGCACTCGCTTGGTCGGACAGCTCTTGTGGATCGCACGGAGG
ATATCAAGTCGCACGCTGGCAACTCGAAAGTCCTCGAAGCGCAGCGCGTTCACCAGCGCGTGCAAGAAAGTTGGCGTGAGGAGACTGTCGGCCGCTGCCG
CTGGAGACGCTGCAGTCGACAGCGACGACGGCGCGTGCAGCTGCAGCTGGCTTTTGAACAGCGCAGTCGCTAGGCCTTGCTTGACGAGCTCTTCATTGGG
TTCGTCCGTGTCGGTCCCTTCGTCGCCAAAGGCCGAGAGCGCTTGGCGCGGACGACGGCGCCGTCCTTCATCCCGGCGGCAAAAGAGCGCCGTAAAGATC
GTGTCAATGACGTCGTCCCGACTTGCGACGCGCTGTGGCAGCCGCTTCTGCTGGCTGAACAGTGTGAGCTGCTGCGGAAAAGCACTCGATGCGGTCTCGG
GGTACACGTCCGCTGCGTCCTGCACAGCTGCAGCAGAAGCAGAAGCAGGAGTCGTTTCGACCTGCTGTTCCAGGGACGCGTCCGGTGGCTGCAGCTCTGT
CGACGTGAGTGACAGTTTGCGTCGGTGCCGCTCGGACGTCGACACTGCCGTCGACTTGATGGACGGCTGGGGATTGAGCCCCTTGGCGCCCATGCGCTGC
CGTCTGCTTCGACTTGAAGCAGCACTTGTGCAGCTGCTCGGTCGGTTCTTCGTCTGCTGTTGTTGGA